VOPP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51940-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VOPP1 Reagents
CRO Services
Product recommended

All VOPP1 Reagents
VOPP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Mouse vesicular, overexpressed in cancer, prosurvival protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VOPP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
AW146242 cDNA ORF Clone, Mouse;Ecop cDNA ORF Clone, Mouse
VOPP1 Background Information
Full Name
vesicular, overexpressed in cancer, prosurvival protein 1

VOPP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VOPP1 cDNA ORF Clone in Cloning Vector, Mouse MG51940-U
VOPP1 cDNA ORF Clone, Mouse, untagged MG51940-UT
VOPP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51940-ACG
VOPP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51940-ACGLN
VOPP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51940-ACR
VOPP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51940-CF
VOPP1 cDNA ORF Clone, Mouse, C-His tag MG51940-CH
VOPP1 cDNA ORF Clone, Mouse, N-His tag MG51940-NH
VOPP1 cDNA ORF Clone, Mouse, C-HA tag MG51940-CY
VOPP1 cDNA ORF Clone, Mouse, N-HA tag MG51940-NY
VOPP1 cDNA ORF Clone, Mouse, C-Myc tag MG51940-CM
VOPP1 cDNA ORF Clone, Mouse, N-Myc tag MG51940-NM
VOPP1 qPCR Primer Pairs, Mouse MP201813

VOPP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VOPP1 cDNA ORF Clone in Cloning Vector, Human HG21282-U
VOPP1 cDNA ORF Clone, Human, untagged HG21282-UT
VOPP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21282-ACGLN
VOPP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG21282-ACG
VOPP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG21282-ACR
VOPP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21282-CF
VOPP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21282-NF
VOPP1 cDNA ORF Clone, Human, C-His tag HG21282-CH
VOPP1 cDNA ORF Clone, Human, N-His tag HG21282-NH
VOPP1 cDNA ORF Clone, Human, C-HA tag HG21282-CY
VOPP1 cDNA ORF Clone, Human, N-HA tag HG21282-NY
VOPP1 cDNA ORF Clone, Human, C-Myc tag HG21282-CM
VOPP1 cDNA ORF Clone, Human, N-Myc tag HG21282-NM
info info
添加购物车成功! 添加购物车失败!