VIPAS39 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52119-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VIPAS39 Reagents
CRO Services
Product recommended

All VIPAS39 Reagents
VIPAS39 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Description
Full length Clone DNA of Mouse VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VIPAS39 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
6720456H09Rik cDNA ORF Clone, Mouse;9330175H22Rik cDNA ORF Clone, Mouse;AI413782 cDNA ORF Clone, Mouse;hSPE-39 cDNA ORF Clone, Mouse;SPE-39 cDNA ORF Clone, Mouse;Spe39 cDNA ORF Clone, Mouse;Vipar cDNA ORF Clone, Mouse
VIPAS39 Background Information
Full Name
VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog

VIPAS39 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VIPAS39 cDNA ORF Clone in Cloning Vector, Mouse MG52119-G
VIPAS39 cDNA ORF Clone, Mouse, untagged MG52119-UT
VIPAS39 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52119-ACG
VIPAS39 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52119-ACGLN
VIPAS39 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52119-ANG
VIPAS39 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52119-ACR
VIPAS39 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52119-ANR
VIPAS39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52119-CF
VIPAS39 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52119-NF
VIPAS39 cDNA ORF Clone, Mouse, C-His tag MG52119-CH
VIPAS39 cDNA ORF Clone, Mouse, N-His tag MG52119-NH
VIPAS39 cDNA ORF Clone, Mouse, C-HA tag MG52119-CY
VIPAS39 cDNA ORF Clone, Mouse, N-HA tag MG52119-NY
VIPAS39 cDNA ORF Clone, Mouse, C-Myc tag MG52119-CM
VIPAS39 qPCR Primer Pairs, Mouse MP201992

VIPAS39 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VIPAS39 cDNA ORF Clone in Cloning Vector, Human HG22032-U
VIPAS39 cDNA ORF Clone, Human, untagged HG22032-UT
VIPAS39 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22032-ACGLN
VIPAS39 cDNA ORF Clone, Human, C-GFPSpark® tag HG22032-ACG
VIPAS39 cDNA ORF Clone, Human, N-GFPSpark® tag HG22032-ANG
VIPAS39 cDNA ORF Clone, Human, C-OFPSpark® tag HG22032-ACR
VIPAS39 cDNA ORF Clone, Human, N-OFPSpark® tag HG22032-ANR
VIPAS39 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22032-CF
VIPAS39 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22032-NF
VIPAS39 cDNA ORF Clone, Human, C-His tag HG22032-CH
VIPAS39 cDNA ORF Clone, Human, N-His tag HG22032-NH
VIPAS39 cDNA ORF Clone, Human, C-HA tag HG22032-CY
VIPAS39 cDNA ORF Clone, Human, N-HA tag HG22032-NY
VIPAS39 cDNA ORF Clone, Human, C-Myc tag HG22032-CM
VIPAS39 cDNA ORF Clone, Human, N-Myc tag HG22032-NM
info info
添加购物车成功! 添加购物车失败!