Vimentin cDNA ORF Clone, Mouse, untagged

Cat: MG50433-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Vimentin Reagents
CRO Services
Product recommended

All Vimentin Reagents
Vimentin cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1401 bp
Description
Full length Clone DNA of Mouse vimentin.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Vimentin Background Information

Vimentin is a type III intermediate filament (IF) protein found in various non-epithelial cells, especially mesenchymal cells. A vimentin monomer, has a central α-helical domain and carboxyl (tail) domains. Two monomers compose the basic subunit of vimentin assembly. Vimentin is crucial for supporting and anchoring the position of the organelles in the cytosol. Vimentin provided cells with a resilience absent from the microtubule or actin filament networks, when under mechanical stress in vivo. Therefore, in general, it is accepted that vimentin is the cytoskeletal component responsible for maintaining cell integrity. Vimentin is also responsible for stabilizing cytoskeletal interactions. It is found that vimentin control the transport of low-density lipoprotein. It has been used as a sarcoma tumor marker to identify mesenchyme.

Full Name
vimentin
References
  • Russell RL, et al. (2001) Uridine phosphorylase association with vimentin. Intracellular distribution and localization. J Biol Chem. 276(16):13302-7.
  • Moinova, et al. (2012) Aberrant Vimentin Methylation is Characteristic of Upper GI Pathologies. Cancer Epidemiology Biomarkers Prev. 21(4):594-600.
  • Leader M, et al. (1987) Vimentin: an evaluation of its role as a tumour marker. Histopathology. 11(1):63-72.
  • Vimentin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Vimentin cDNA ORF Clone in Cloning Vector, Rat RG81959-U
    Vimentin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81959-ACGLN

    Vimentin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Vimentin cDNA ORF Clone in Cloning Vector, Mouse MG50433-M
    Vimentin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50433-ACGLN
    Vimentin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50433-ACG
    Vimentin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50433-ANG
    Vimentin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50433-ACR
    Vimentin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50433-ANR
    Vimentin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50433-CF
    Vimentin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50433-NF
    Vimentin cDNA ORF Clone, Mouse, C-His tag MG50433-CH
    Vimentin cDNA ORF Clone, Mouse, N-His tag MG50433-NH
    Vimentin cDNA ORF Clone, Mouse, C-HA tag MG50433-CY
    Vimentin cDNA ORF Clone, Mouse, N-HA tag MG50433-NY
    Vimentin cDNA ORF Clone, Mouse, C-Myc tag MG50433-CM
    Vimentin cDNA ORF Clone, Mouse, N-Myc tag MG50433-NM
    Vimentin qPCR Primer Pairs, Mouse MP200442

    Vimentin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Vimentin cDNA ORF Clone, Human, untagged HG10028-UT
    Vimentin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10028-ACGLN
    Vimentin cDNA ORF Clone, Human, N-GFPSpark® tag HG10028-ANG
    Vimentin cDNA ORF Clone, Human, C-OFPSpark® tag HG10028-ACR
    Vimentin cDNA ORF Clone, Human, N-OFPSpark® tag HG10028-ANR
    Vimentin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10028-M-F
    Vimentin qPCR Primer Pairs, Human HP100124
    info info
    添加购物车成功! 添加购物车失败!