After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse VIM natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse VIM cDNA Clone Product Information
NCBI RefSeq:NM_011701.4
RefSeq ORF Size:1401bp
cDNA Description:Full length Clone DNA of Mus musculus vimentin.
Gene Synonym:MGC102095, Vim
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Vimentin is a type III intermediate filament (IF) protein found in various non-epithelial cells, especially mesenchymal cells. A vimentin monomer, has a central α-helical domain and carboxyl (tail) domains. Two monomers compose the basic subunit of vimentin assembly. Vimentin is crucial for supporting and anchoring the position of the organelles in the cytosol. Vimentin provided cells with a resilience absent from the microtubule or actin filament networks, when under mechanical stress in vivo. Therefore, in general, it is accepted that vimentin is the cytoskeletal component responsible for maintaining cell integrity. Vimentin is also responsible for stabilizing cytoskeletal interactions. It is found that vimentin control the transport of low-density lipoprotein. It has been used as a sarcoma tumor marker to identify mesenchyme.

References
  • Russell RL, et al. (2001) Uridine phosphorylase association with vimentin. Intracellular distribution and localization. J Biol Chem. 276(16):13302-7.
  • Moinova, et al. (2012) Aberrant Vimentin Methylation is Characteristic of Upper GI Pathologies. Cancer Epidemiology Biomarkers Prev. 21(4):594-600.
  • Leader M, et al. (1987) Vimentin: an evaluation of its role as a tumour marker. Histopathology. 11(1):63-72.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"