After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse Vimentin Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse VIM cDNA Clone Product Information
NCBI RefSeq:NM_011701.4
RefSeq ORF Size:1401bp
cDNA Description:Full length Clone DNA of Mus musculus vimentin with C terminal Flag tag.
Gene Synonym:MGC102095, Vim
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-mVIM-flag
Restriction Site:KpnI + XbaI (6kb + 1.44kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse VIM Gene Plasmid Map
Mouse VIM natural ORF mammalian expression plasmid, C-Flag tag
Mouse VIM Gene Expression validated Image
Mouse VIM natural ORF mammalian expression plasmid, C-Flag tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Vimentin is a type III intermediate filament (IF) protein found in various non-epithelial cells, especially mesenchymal cells. A vimentin monomer, has a central α-helical domain and carboxyl (tail) domains. Two monomers compose the basic subunit of vimentin assembly. Vimentin is crucial for supporting and anchoring the position of the organelles in the cytosol. Vimentin provided cells with a resilience absent from the microtubule or actin filament networks, when under mechanical stress in vivo. Therefore, in general, it is accepted that vimentin is the cytoskeletal component responsible for maintaining cell integrity. Vimentin is also responsible for stabilizing cytoskeletal interactions. It is found that vimentin control the transport of low-density lipoprotein. It has been used as a sarcoma tumor marker to identify mesenchyme.

References
  • Russell RL, et al. (2001) Uridine phosphorylase association with vimentin. Intracellular distribution and localization. J Biol Chem. 276(16):13302-7.
  • Moinova, et al. (2012) Aberrant Vimentin Methylation is Characteristic of Upper GI Pathologies. Cancer Epidemiology Biomarkers Prev. 21(4):594-600.
  • Leader M, et al. (1987) Vimentin: an evaluation of its role as a tumour marker. Histopathology. 11(1):63-72.
  • Size / Price
    Catalog: MG50433-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse VIM natural ORF mammalian expression plasmid, C-Flag tag
    • Mouse VIM natural ORF mammalian expression plasmid, C-Flag tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"