Quick Order

Text Size:AAA

Mouse VEGFC/VEGF-C/Flt4-L Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse VEGFC cDNA Clone Product Information
NCBI RefSeq:NM_009506.2
RefSeq ORF Size:1242bp
cDNA Description:Full length Clone DNA of Mus musculus vascular endothelial growth factor C with C terminal Myc tag.
Gene Synonym:VEGF-C, AW228853, Vegfc
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Vascular endothelial growth factor C (VEGF-C) is a member of the VEGF family. Upon biosynthesis, VEGF-C protein is secreted as a non-covalent momodimer in an anti-parellel fashion. VEGF-C protein is a dimeric glycoprotein, as a ligand for two receptors, VEGFR-3 (Flt4), and VEGFR-2. VEGF-C may function in angiogenesis of the venous and lymphatic vascular systems during embryogenesis. VEGF-C protein is over-expressed in various human cancers including breast cancer and prostate cancer. VEGF-C/VEGFR-3 axis, through different signaling pathways, plays a critical role in cancer progression by regulating different cellular functions, such as invasion, proliferation, and resistance to chemotherapy. Thus, targeting the VEGF-C/VEGFR-3 axis may be therapeutically significant for certain types of tumors.

References
  • Joukov V, et al. (1997) Vascular endothelial growth factors VEGF-B and VEGF-C. J Cell Physiol. 173(2): 211-5.
  • Su JL, et al. (2007) The role of the VEGF-C/VEGFR-3 axis in cancer progression. Br J Cancer. 96(4): 541-5.
  • Anisimov A, et al. (2009) Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle. Circ Res. 104(11): 1302-12.
  • Size / Price
    Catalog: MG50391-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"