VDR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51106-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VDR Reagents
CRO Services
Product recommended

All VDR Reagents
VDR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1269 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse vitamin D receptor with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.32kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
VDR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VDR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Mouse VDR-NR111 Gene Expression validated Image 14182
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
VDR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Nr1i1 cDNA ORF Clone, Mouse
VDR Background Information

VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.

Full Name
vitamin D (1,25- dihydroxyvitamin D3) receptor
References
  • Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.
  • Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.
  • Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.
  • Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.
  • Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.
  • VDR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VDR cDNA ORF Clone in Cloning Vector, Mouse MG51106-G
    VDR cDNA ORF Clone, Mouse, untagged MG51106-UT
    VDR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51106-ACGLN
    VDR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51106-ACG
    VDR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51106-ANG
    VDR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51106-ACR
    VDR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51106-ANR
    VDR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51106-NF
    VDR cDNA ORF Clone, Mouse, C-His tag MG51106-CH
    VDR cDNA ORF Clone, Mouse, N-His tag MG51106-NH
    VDR cDNA ORF Clone, Mouse, C-HA tag MG51106-CY
    VDR cDNA ORF Clone, Mouse, N-HA tag MG51106-NY
    VDR cDNA ORF Clone, Mouse, C-Myc tag MG51106-CM
    VDR cDNA ORF Clone, Mouse, N-Myc tag MG51106-NM
    VDR qPCR Primer Pairs, Mouse MP201059

    VDR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VDR cDNA ORF Clone in Cloning Vector, Human HG12025-G
    VDR cDNA ORF Clone, Human, untagged HG12025-UT
    VDR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12025-ACGLN
    VDR cDNA ORF Clone, Human, C-GFPSpark® tag HG12025-ACG
    VDR cDNA ORF Clone, Human, N-GFPSpark® tag HG12025-ANG
    VDR cDNA ORF Clone, Human, C-OFPSpark® tag HG12025-ACR
    VDR cDNA ORF Clone, Human, N-OFPSpark® tag HG12025-ANR
    VDR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12025-CF
    VDR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12025-NF
    VDR cDNA ORF Clone, Human, C-His tag HG12025-CH
    VDR cDNA ORF Clone, Human, N-His tag HG12025-NH
    VDR cDNA ORF Clone, Human, C-HA tag HG12025-CY
    VDR cDNA ORF Clone, Human, N-HA tag HG12025-NY
    VDR cDNA ORF Clone, Human, C-Myc tag HG12025-CM
    VDR cDNA ORF Clone, Human, N-Myc tag HG12025-NM
    VDR qPCR Primer Pairs, Human HP101561
    info info
    添加购物车成功! 添加购物车失败!