Porin cDNA ORF Clone, Mouse, C-His tag

Cat: MG52370-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Porin Reagents
CRO Services
Product recommended

All Porin Reagents
Porin cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
852 bp
Description
Full length Clone DNA of Mouse voltage-dependent anion channel 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Porin cDNA ORF Clone, Mouse, C-His tag Alternative Names
AL033343 cDNA ORF Clone, Mouse;Vdac5 cDNA ORF Clone, Mouse
Porin Background Information
Full Name
voltage-dependent anion channel 1

Porin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Porin cDNA ORF Clone in Cloning Vector, Mouse MG52370-G
Porin cDNA ORF Clone, Mouse, untagged MG52370-UT
Porin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52370-ACGLN
Porin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52370-ACG
Porin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52370-ACR
Porin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52370-CF
Porin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52370-NF
Porin cDNA ORF Clone, Mouse, N-His tag MG52370-NH
Porin cDNA ORF Clone, Mouse, C-HA tag MG52370-CY
Porin cDNA ORF Clone, Mouse, N-HA tag MG52370-NY
Porin cDNA ORF Clone, Mouse, C-Myc tag MG52370-CM
Porin cDNA ORF Clone, Mouse, N-Myc tag MG52370-NM
Porin qPCR Primer Pairs, Mouse MP202243

Porin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Porin cDNA ORF Clone in Cloning Vector, Human HG17755-U
Porin cDNA ORF Clone, Human, untagged HG17755-UT
Porin cDNA ORF Clone, Human, C-GFPSpark® tag HG17755-ACG
Porin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17755-ACGLN
Porin cDNA ORF Clone, Human, N-GFPSpark® tag HG17755-ANG
Porin cDNA ORF Clone, Human, C-OFPSpark® tag HG17755-ACR
Porin cDNA ORF Clone, Human, N-OFPSpark® tag HG17755-ANR
Porin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17755-CF
Porin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17755-NF
Porin cDNA ORF Clone, Human, C-His tag HG17755-CH
Porin cDNA ORF Clone, Human, N-His tag HG17755-NH
Porin cDNA ORF Clone, Human, C-HA tag HG17755-CY
Porin cDNA ORF Clone, Human, N-HA tag HG17755-NY
Porin cDNA ORF Clone, Human, C-Myc tag HG17755-CM
Porin cDNA ORF Clone, Human, N-Myc tag HG17755-NM
info info
添加购物车成功! 添加购物车失败!