VAT1L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52296-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VAT1L Reagents
CRO Services
Product recommended

All VAT1L Reagents
VAT1L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Description
Full length Clone DNA of Mouse vesicle amine transport protein 1 homolog-like (T. californica) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VAT1L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
9430073I07 cDNA ORF Clone, Mouse;AI427515 cDNA ORF Clone, Mouse;mKIAA1576 cDNA ORF Clone, Mouse
VAT1L Background Information
Full Name
vesicle amine transport 1-like

VAT1L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VAT1L cDNA ORF Clone in Cloning Vector, Mouse MG52296-G
VAT1L cDNA ORF Clone, Mouse, untagged MG52296-UT
VAT1L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52296-ACGLN
VAT1L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52296-ACG
VAT1L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52296-ANG
VAT1L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52296-ACR
VAT1L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52296-ANR
VAT1L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52296-NF
VAT1L cDNA ORF Clone, Mouse, C-His tag MG52296-CH
VAT1L cDNA ORF Clone, Mouse, N-His tag MG52296-NH
VAT1L cDNA ORF Clone, Mouse, C-HA tag MG52296-CY
VAT1L cDNA ORF Clone, Mouse, N-HA tag MG52296-NY
VAT1L cDNA ORF Clone, Mouse, C-Myc tag MG52296-CM
VAT1L cDNA ORF Clone, Mouse, N-Myc tag MG52296-NM
VAT1L qPCR Primer Pairs, Mouse MP202169

VAT1L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VAT1L cDNA ORF Clone in Cloning Vector, Human HG14782-G
VAT1L cDNA ORF Clone, Human, untagged HG14782-UT
VAT1L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14782-ACGLN
VAT1L cDNA ORF Clone, Human, C-GFPSpark® tag HG14782-ACG
VAT1L cDNA ORF Clone, Human, N-GFPSpark® tag HG14782-ANG
VAT1L cDNA ORF Clone, Human, C-OFPSpark® tag HG14782-ACR
VAT1L cDNA ORF Clone, Human, N-OFPSpark® tag HG14782-ANR
VAT1L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14782-CF
VAT1L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14782-NF
VAT1L cDNA ORF Clone, Human, C-His tag HG14782-CH
VAT1L cDNA ORF Clone, Human, N-His tag HG14782-NH
VAT1L cDNA ORF Clone, Human, C-HA tag HG14782-CY
VAT1L cDNA ORF Clone, Human, N-HA tag HG14782-NY
VAT1L cDNA ORF Clone, Human, C-Myc tag HG14782-CM
VAT1L cDNA ORF Clone, Human, N-Myc tag HG14782-NM
VAT1L qPCR Primer Pairs, Human HP103415
info info
添加购物车成功! 添加购物车失败!