VAPA cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52625-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VAPA Reagents
CRO Services
Product recommended

All VAPA Reagents
VAPA cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Mouse vesicle-associated membrane protein, associated protein A with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VAPA cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
33kDa cDNA ORF Clone, Mouse;VAP33 cDNA ORF Clone, Mouse
VAPA Background Information
Full Name
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa

VAPA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VAPA cDNA ORF Clone in Cloning Vector, Mouse MG52625-G
VAPA cDNA ORF Clone, Mouse, untagged MG52625-UT
VAPA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52625-ACGLN
VAPA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52625-ACG
VAPA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52625-ANG
VAPA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52625-ACR
VAPA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52625-ANR
VAPA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52625-CF
VAPA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52625-NF
VAPA cDNA ORF Clone, Mouse, C-His tag MG52625-CH
VAPA cDNA ORF Clone, Mouse, N-His tag MG52625-NH
VAPA cDNA ORF Clone, Mouse, C-HA tag MG52625-CY
VAPA cDNA ORF Clone, Mouse, N-HA tag MG52625-NY
VAPA cDNA ORF Clone, Mouse, C-Myc tag MG52625-CM
VAPA qPCR Primer Pairs, Mouse MP202496

VAPA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VAPA cDNA ORF Clone in Cloning Vector, Human HG11412-M
VAPA cDNA ORF Clone, Human, untagged HG11412-UT
VAPA cDNA ORF Clone, Human, C-GFPSpark® tag HG11412-ACG
VAPA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11412-ACGLN
VAPA cDNA ORF Clone, Human, N-GFPSpark® tag HG11412-ANG
VAPA cDNA ORF Clone, Human, C-OFPSpark® tag HG11412-ACR
VAPA cDNA ORF Clone, Human, N-OFPSpark® tag HG11412-ANR
VAPA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11412-CF
VAPA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11412-NF
VAPA cDNA ORF Clone, Human, C-His tag HG11412-CH
VAPA cDNA ORF Clone, Human, N-His tag HG11412-NH
VAPA cDNA ORF Clone, Human, C-HA tag HG11412-CY
VAPA cDNA ORF Clone, Human, N-HA tag HG11412-NY
VAPA cDNA ORF Clone, Human, C-Myc tag HG11412-CM
VAPA cDNA ORF Clone, Human, N-Myc tag HG11412-NM
VAPA qPCR Primer Pairs, Human HP101290
info info
添加购物车成功! 添加购物车失败!