VAMP3 cDNA ORF Clone, Mouse, untagged

Cat: MG51490-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VAMP3 Reagents
CRO Services
Product recommended

All VAMP3 Reagents
VAMP3 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
312 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse vesicle-associated membrane protein 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+0.31kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
VAMP3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VAMP3 cDNA ORF Clone, Mouse, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
VAMP3 cDNA ORF Clone, Mouse, untagged Alternative Names
ceb cDNA ORF Clone, Mouse;D130027G05Rik cDNA ORF Clone, Mouse;VAMP-3 cDNA ORF Clone, Mouse
VAMP3 Background Information

VAMP3, also known as cellubrevin, is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. Because of VAMP3 gene's high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, VAMP3 was shown to be the human equivalent of the rodent cellubrevin. In platelets VAMP3 resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation.

Full Name
vesicle-associated membrane protein 3
References
  • Bernstein AM. et al., 1999, Blood. 93 (2): 571-9.
  • Annaert WG. et al., 1997, J Cell Biol. 139 (6): 1397-410.
  • Hager HA. et al., 2010, EMBO J. 29 (3): 532-45.
  • VAMP3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VAMP3 cDNA ORF Clone in Cloning Vector, Mouse MG51490-G
    VAMP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51490-ACGLN
    VAMP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51490-ACG
    VAMP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51490-ANG
    VAMP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51490-ACR
    VAMP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51490-ANR
    VAMP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51490-CF
    VAMP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51490-NF
    VAMP3 cDNA ORF Clone, Mouse, C-His tag MG51490-CH
    VAMP3 cDNA ORF Clone, Mouse, N-His tag MG51490-NH
    VAMP3 cDNA ORF Clone, Mouse, C-HA tag MG51490-CY
    VAMP3 cDNA ORF Clone, Mouse, N-HA tag MG51490-NY
    VAMP3 cDNA ORF Clone, Mouse, C-Myc tag MG51490-CM
    VAMP3 cDNA ORF Clone, Mouse, N-Myc tag MG51490-NM
    VAMP3 qPCR Primer Pairs, Mouse MP201374

    VAMP3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VAMP3 cDNA ORF Clone in Cloning Vector, Human HG14481-G
    VAMP3 cDNA ORF Clone, Human, untagged HG14481-UT
    VAMP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14481-ACG
    VAMP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14481-ACGLN
    VAMP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14481-ANG
    VAMP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14481-ACR
    VAMP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14481-ANR
    VAMP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14481-CF
    VAMP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14481-NF
    VAMP3 cDNA ORF Clone, Human, C-His tag HG14481-CH
    VAMP3 cDNA ORF Clone, Human, N-His tag HG14481-NH
    VAMP3 cDNA ORF Clone, Human, C-HA tag HG14481-CY
    VAMP3 cDNA ORF Clone, Human, N-HA tag HG14481-NY
    VAMP3 cDNA ORF Clone, Human, C-Myc tag HG14481-CM
    VAMP3 cDNA ORF Clone, Human, N-Myc tag HG14481-NM
    VAMP3 qPCR Primer Pairs, Human HP103129
    info info
    添加购物车成功! 添加购物车失败!