After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse VAMP3 / Cellubrevin Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse VAMP3 cDNA Clone Product Information
NCBI RefSeq:NM_009498.4
RefSeq ORF Size:312bp
cDNA Description:Full length Clone DNA of Mus musculus vesicle-associated membrane protein 3.
Gene Synonym:ceb, VAMP-3, D130027G05Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

VAMP3, also known as cellubrevin, is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. Because of VAMP3 gene's high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, VAMP3 was shown to be the human equivalent of the rodent cellubrevin. In platelets VAMP3 resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation.

References
  • Bernstein AM. et al., 1999, Blood. 93 (2): 571-9.
  • Annaert WG. et al., 1997, J Cell Biol. 139 (6): 1397-410.
  • Hager HA. et al., 2010, EMBO J. 29 (3): 532-45.
  • Size / Price
    Catalog: MG51490-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"