VAMP1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52302-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VAMP1 Reagents
CRO Services
Product recommended

All VAMP1 Reagents
VAMP1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
354 bp
Description
Full length Clone DNA of Mouse vesicle-associated membrane protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VAMP1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
lew cDNA ORF Clone, Mouse;Syb-1 cDNA ORF Clone, Mouse;Syb1 cDNA ORF Clone, Mouse;VAMP-1 cDNA ORF Clone, Mouse
VAMP1 Background Information
Full Name
vesicle-associated membrane protein 1 (synaptobrevin 1)

VAMP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VAMP1 cDNA ORF Clone in Cloning Vector, Mouse MG52302-U
VAMP1 cDNA ORF Clone, Mouse, untagged MG52302-UT
VAMP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52302-ACGLN
VAMP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52302-ACG
VAMP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52302-ANG
VAMP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52302-ACR
VAMP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52302-ANR
VAMP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52302-CF
VAMP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52302-NF
VAMP1 cDNA ORF Clone, Mouse, C-His tag MG52302-CH
VAMP1 cDNA ORF Clone, Mouse, N-His tag MG52302-NH
VAMP1 cDNA ORF Clone, Mouse, C-HA tag MG52302-CY
VAMP1 cDNA ORF Clone, Mouse, C-Myc tag MG52302-CM
VAMP1 cDNA ORF Clone, Mouse, N-Myc tag MG52302-NM
VAMP1 qPCR Primer Pairs, Mouse MP202175

VAMP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VAMP1 cDNA ORF Clone in Cloning Vector, Human HG12220-G
VAMP1 cDNA ORF Clone, Human, untagged HG12220-UT
VAMP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12220-ACG
VAMP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12220-ACGLN
VAMP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12220-ANG
VAMP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12220-ACR
VAMP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12220-ANR
VAMP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12220-CF
VAMP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12220-NF
VAMP1 cDNA ORF Clone, Human, C-His tag HG12220-CH
VAMP1 cDNA ORF Clone, Human, N-His tag HG12220-NH
VAMP1 cDNA ORF Clone, Human, C-HA tag HG12220-CY
VAMP1 cDNA ORF Clone, Human, N-HA tag HG12220-NY
VAMP1 cDNA ORF Clone, Human, C-Myc tag HG12220-CM
VAMP1 cDNA ORF Clone, Human, N-Myc tag HG12220-NM
VAMP1 qPCR Primer Pairs, Human HP101854
info info
添加购物车成功! 添加购物车失败!