USP39 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51777-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All USP39 Reagents
CRO Services
Product recommended

All USP39 Reagents
USP39 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1695 bp
Description
Full length Clone DNA of Mouse ubiquitin specific peptidase 39 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

USP39 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AA408960 cDNA ORF Clone, Mouse;AI894154 cDNA ORF Clone, Mouse;CGI-21 cDNA ORF Clone, Mouse;D6Wsu157e cDNA ORF Clone, Mouse;SAD1 cDNA ORF Clone, Mouse
USP39 Background Information
Full Name
ubiquitin specific peptidase 39

USP39 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
USP39 cDNA ORF Clone in Cloning Vector, Mouse MG51777-G
USP39 cDNA ORF Clone, Mouse, untagged MG51777-UT
USP39 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51777-ACGLN
USP39 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51777-ACG
USP39 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51777-ANG
USP39 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51777-ACR
USP39 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51777-ANR
USP39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51777-CF
USP39 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51777-NF
USP39 cDNA ORF Clone, Mouse, C-His tag MG51777-CH
USP39 cDNA ORF Clone, Mouse, N-His tag MG51777-NH
USP39 cDNA ORF Clone, Mouse, C-HA tag MG51777-CY
USP39 cDNA ORF Clone, Mouse, N-HA tag MG51777-NY
USP39 cDNA ORF Clone, Mouse, N-Myc tag MG51777-NM
USP39 qPCR Primer Pairs, Mouse MP201650

USP39 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
USP39 cDNA ORF Clone in Cloning Vector, Human HG13845-G
USP39 cDNA ORF Clone, Human, untagged HG13845-UT
USP39 cDNA ORF Clone, Human, C-GFPSpark® tag HG13845-ACG
USP39 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13845-ACGLN
USP39 cDNA ORF Clone, Human, N-GFPSpark® tag HG13845-ANG
USP39 cDNA ORF Clone, Human, C-OFPSpark® tag HG13845-ACR
USP39 cDNA ORF Clone, Human, N-OFPSpark® tag HG13845-ANR
USP39 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13845-CF
USP39 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13845-NF
USP39 cDNA ORF Clone, Human, C-His tag HG13845-CH
USP39 cDNA ORF Clone, Human, N-His tag HG13845-NH
USP39 cDNA ORF Clone, Human, C-HA tag HG13845-CY
USP39 cDNA ORF Clone, Human, N-HA tag HG13845-NY
USP39 cDNA ORF Clone, Human, C-Myc tag HG13845-CM
USP39 cDNA ORF Clone, Human, N-Myc tag HG13845-NM
USP39 qPCR Primer Pairs, Human HP102517
info info
添加购物车成功! 添加购物车失败!