Harmonin cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50803-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Harmonin Reagents
CRO Services
Product recommended

All Harmonin Reagents
Harmonin cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1647 bp
Description
Full length Clone DNA of Mouse Usher syndrome 1C homolog (human) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Harmonin cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2010016F01Rik cDNA ORF Clone, Mouse;harmonin cDNA ORF Clone, Mouse
Harmonin Background Information

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

Full Name
Usher syndrome 1C (autosomal recessive, severe)
References
  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • Harmonin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Harmonin cDNA ORF Clone in Cloning Vector, Mouse MG50803-G
    Harmonin cDNA ORF Clone, Mouse, untagged MG50803-UT
    Harmonin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50803-ACGLN
    Harmonin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50803-ACG
    Harmonin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50803-ANG
    Harmonin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50803-ACR
    Harmonin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50803-ANR
    Harmonin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50803-CF
    Harmonin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50803-NF
    Harmonin cDNA ORF Clone, Mouse, C-His tag MG50803-CH
    Harmonin cDNA ORF Clone, Mouse, N-His tag MG50803-NH
    Harmonin cDNA ORF Clone, Mouse, C-HA tag MG50803-CY
    Harmonin cDNA ORF Clone, Mouse, N-HA tag MG50803-NY
    Harmonin cDNA ORF Clone, Mouse, C-Myc tag MG50803-CM
    Harmonin qPCR Primer Pairs, Mouse MP200774

    Harmonin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Harmonin cDNA ORF Clone in Cloning Vector, Human HG10613-M
    Harmonin cDNA ORF Clone, Human, untagged HG10613-UT
    Harmonin cDNA ORF Clone, Human, C-GFPSpark® tag HG10613-ACG
    Harmonin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10613-ACGLN
    Harmonin cDNA ORF Clone, Human, N-GFPSpark® tag HG10613-ANG
    Harmonin cDNA ORF Clone, Human, C-OFPSpark® tag HG10613-ACR
    Harmonin cDNA ORF Clone, Human, N-OFPSpark® tag HG10613-ANR
    Harmonin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10613-CF
    Harmonin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10613-NF
    Harmonin cDNA ORF Clone, Human, C-His tag HG10613-CH
    Harmonin cDNA ORF Clone, Human, N-His tag HG10613-NH
    Harmonin cDNA ORF Clone, Human, C-HA tag HG10613-CY
    Harmonin cDNA ORF Clone, Human, N-HA tag HG10613-NY
    Harmonin cDNA ORF Clone, Human, C-Myc tag HG10613-CM
    Harmonin cDNA ORF Clone, Human, N-Myc tag HG10613-NM
    Harmonin qPCR Primer Pairs, Human HP100863
    info info
    添加购物车成功! 添加购物车失败!