After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse USH1C/Harmonin Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse USH1C cDNA Clone Product Information
NCBI RefSeq:NM_023649.2
RefSeq ORF Size:1647bp
cDNA Description:Full length Clone DNA of Mus musculus Usher syndrome 1C homolog (human) with N terminal His tag.
Gene Synonym:harmonin, 2010016F01Rik, Ush1c
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

References
  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • Size / Price
    Catalog: MG50803-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"