UQCRH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51248-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UQCRH Reagents
CRO Services
Product recommended

All UQCRH Reagents
UQCRH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
270 bp
Description
Full length Clone DNA of Mouse ubiquinol-cytochrome c reductase hinge protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UQCRH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2210416J04Rik cDNA ORF Clone, Mouse;2310021J10Rik cDNA ORF Clone, Mouse;2610041P16Rik cDNA ORF Clone, Mouse
UQCRH Background Information
Full Name
ubiquinol-cytochrome c reductase hinge protein

UQCRH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UQCRH cDNA ORF Clone in Cloning Vector, Mouse MG51248-U
UQCRH cDNA ORF Clone, Mouse, untagged MG51248-UT
UQCRH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51248-ACG
UQCRH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51248-ACGLN
UQCRH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51248-ANG
UQCRH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51248-ACR
UQCRH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51248-ANR
UQCRH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51248-CF
UQCRH cDNA ORF Clone, Mouse, C-His tag MG51248-CH
UQCRH cDNA ORF Clone, Mouse, N-His tag MG51248-NH
UQCRH cDNA ORF Clone, Mouse, C-HA tag MG51248-CY
UQCRH cDNA ORF Clone, Mouse, N-HA tag MG51248-NY
UQCRH cDNA ORF Clone, Mouse, C-Myc tag MG51248-CM
UQCRH cDNA ORF Clone, Mouse, N-Myc tag MG51248-NM
UQCRH qPCR Primer Pairs, Mouse MP201131

UQCRH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UQCRH cDNA ORF Clone in Cloning Vector, Human HG16217-G
UQCRH cDNA ORF Clone, Human, untagged HG16217-UT
UQCRH cDNA ORF Clone, Human, C-GFPSpark® tag HG16217-ACG
UQCRH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16217-ACGLN
UQCRH cDNA ORF Clone, Human, N-GFPSpark® tag HG16217-ANG
UQCRH cDNA ORF Clone, Human, C-OFPSpark® tag HG16217-ACR
UQCRH cDNA ORF Clone, Human, N-OFPSpark® tag HG16217-ANR
UQCRH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16217-CF
UQCRH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16217-NF
UQCRH cDNA ORF Clone, Human, C-His tag HG16217-CH
UQCRH cDNA ORF Clone, Human, N-His tag HG16217-NH
UQCRH cDNA ORF Clone, Human, C-HA tag HG16217-CY
UQCRH cDNA ORF Clone, Human, N-HA tag HG16217-NY
UQCRH cDNA ORF Clone, Human, C-Myc tag HG16217-CM
UQCRH cDNA ORF Clone, Human, N-Myc tag HG16217-NM
UQCRH qPCR Primer Pairs, Human HP104982
info info
添加购物车成功! 添加购物车失败!