UNC50 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52946-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UNC50 Reagents
CRO Services
Product recommended

All UNC50 Reagents
UNC50 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
780 bp
Description
Full length Clone DNA of Mouse unc-50 homolog (C. elegans) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UNC50 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110002A21Rik cDNA ORF Clone, Mouse;GMH1 cDNA ORF Clone, Mouse;UNCL cDNA ORF Clone, Mouse;URP cDNA ORF Clone, Mouse
UNC50 Background Information
Full Name
unc-50 homolog (C. elegans)

UNC50 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UNC50 cDNA ORF Clone in Cloning Vector, Rat RG81314-U
UNC50 cDNA ORF Clone, Rat, untagged RG81314-UT
UNC50 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81314-ACG
UNC50 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81314-ACGLN
UNC50 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81314-ACR
UNC50 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81314-CF
UNC50 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81314-NF
UNC50 cDNA ORF Clone, Rat, C-His tag RG81314-CH
UNC50 cDNA ORF Clone, Rat, N-His tag RG81314-NH
UNC50 cDNA ORF Clone, Rat, C-HA tag RG81314-CY
UNC50 cDNA ORF Clone, Rat, N-HA tag RG81314-NY
UNC50 cDNA ORF Clone, Rat, C-Myc tag RG81314-CM
UNC50 cDNA ORF Clone, Rat, N-Myc tag RG81314-NM
UNC50 qPCR Primer Pairs, Rat RP301270

UNC50 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UNC50 cDNA ORF Clone in Cloning Vector, Mouse MG52946-G
UNC50 cDNA ORF Clone, Mouse, untagged MG52946-UT
UNC50 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52946-ACG
UNC50 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52946-ACGLN
UNC50 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52946-ANG
UNC50 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52946-ACR
UNC50 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52946-ANR
UNC50 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52946-CF
UNC50 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52946-NF
UNC50 cDNA ORF Clone, Mouse, C-His tag MG52946-CH
UNC50 cDNA ORF Clone, Mouse, N-His tag MG52946-NH
UNC50 cDNA ORF Clone, Mouse, C-HA tag MG52946-CY
UNC50 cDNA ORF Clone, Mouse, N-HA tag MG52946-NY
UNC50 cDNA ORF Clone, Mouse, N-Myc tag MG52946-NM

UNC50 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UNC50 cDNA ORF Clone in Cloning Vector, Human HG16311-G
UNC50 cDNA ORF Clone, Human, untagged HG16311-UT
UNC50 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16311-ACGLN
UNC50 cDNA ORF Clone, Human, C-GFPSpark® tag HG16311-ACG
UNC50 cDNA ORF Clone, Human, N-GFPSpark® tag HG16311-ANG
UNC50 cDNA ORF Clone, Human, C-OFPSpark® tag HG16311-ACR
UNC50 cDNA ORF Clone, Human, N-OFPSpark® tag HG16311-ANR
UNC50 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16311-CF
UNC50 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16311-NF
UNC50 cDNA ORF Clone, Human, C-His tag HG16311-CH
UNC50 cDNA ORF Clone, Human, N-His tag HG16311-NH
UNC50 cDNA ORF Clone, Human, C-HA tag HG16311-CY
UNC50 cDNA ORF Clone, Human, N-HA tag HG16311-NY
UNC50 cDNA ORF Clone, Human, C-Myc tag HG16311-CM
UNC50 cDNA ORF Clone, Human, N-Myc tag HG16311-NM
UNC50 qPCR Primer Pairs, Human HP105065
info info
添加购物车成功! 添加购物车失败!