UCK1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52247-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UCK1 Reagents
CRO Services
Product recommended

All UCK1 Reagents
UCK1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
852 bp
Description
Full length Clone DNA of Mouse uridine-cytidine kinase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UCK1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Umpk cDNA ORF Clone, Mouse;URK1 cDNA ORF Clone, Mouse
UCK1 Background Information
Full Name
uridine-cytidine kinase 1

UCK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UCK1 cDNA ORF Clone in Cloning Vector, Mouse MG52247-G
UCK1 cDNA ORF Clone, Mouse, untagged MG52247-UT
UCK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52247-ACG
UCK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52247-ACGLN
UCK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52247-ANG
UCK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52247-ACR
UCK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52247-ANR
UCK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52247-CF
UCK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52247-NF
UCK1 cDNA ORF Clone, Mouse, C-His tag MG52247-CH
UCK1 cDNA ORF Clone, Mouse, N-His tag MG52247-NH
UCK1 cDNA ORF Clone, Mouse, C-HA tag MG52247-CY
UCK1 cDNA ORF Clone, Mouse, C-Myc tag MG52247-CM
UCK1 cDNA ORF Clone, Mouse, N-Myc tag MG52247-NM
UCK1 qPCR Primer Pairs, Mouse MP202120

UCK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UCK1 cDNA ORF Clone in Cloning Vector, Human HG23945-U
UCK1 cDNA ORF Clone, Human, untagged HG23945-UT
UCK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23945-ACGLN
UCK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG23945-ACG
UCK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG23945-ANG
UCK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG23945-ACR
UCK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG23945-ANR
UCK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23945-CF
UCK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23945-NF
UCK1 cDNA ORF Clone, Human, C-His tag HG23945-CH
UCK1 cDNA ORF Clone, Human, N-His tag HG23945-NH
UCK1 cDNA ORF Clone, Human, C-HA tag HG23945-CY
UCK1 cDNA ORF Clone, Human, N-HA tag HG23945-NY
UCK1 cDNA ORF Clone, Human, C-Myc tag HG23945-CM
UCK1 cDNA ORF Clone, Human, N-Myc tag HG23945-NM
info info
添加购物车成功! 添加购物车失败!