UBC9 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52988-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBC9 Reagents
CRO Services
Product recommended

All UBC9 Reagents
UBC9 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Mouse ubiquitin-conjugating enzyme E2I with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBC9 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
5830467E05Rik cDNA ORF Clone, Mouse;F830028O17Rik cDNA ORF Clone, Mouse;UBC9 cDNA ORF Clone, Mouse;Ubce2i cDNA ORF Clone, Mouse;Ubce9 cDNA ORF Clone, Mouse
UBC9 Background Information

UBE2I is a member of the ubiquitin-conjugating E2 family whose members perform the second step in the ubiquitination reaction. Initially identified as the main process for protein degradation, ubiquitination is believed nowadays to be crucial for a wider range of cellular processes. The outcome of the ubiquitin-conjugation reaction, and thereby the fate of the substrate, is heavily dependent on the number of ubiquitin molecules attached and how these ubiquitin molecules are inter-connected. To deal with this complexity and to allow adequate ubiquitination in time and space, a highly sophisticated conjugation machinery has been developed. In a sequential manner, ubiquitin becomes activated by an ubiquitin-activating enzyme (E1), which then transfers the ubiquitin to a group of ubiquitin-conjugating enzymes (E2s). Next, ubiquitin-loaded E2s are interacting with ubiquitin protein ligases (E3s) and ubiquitin is conjugated to substrates on recruitment by the E3. These three key enzymes are operating in a hierarchical system, wherein two E1s and 35 E2s have been found and hundreds of E3s have been identified in humans. 

Full Name
ubiquitin-conjugating enzyme E2I
References
  • Sjoerd J L van Wijk, et al. (2009) A comprehensive framework of E2-RING E3 interactions of the human ubiquitin-proteasome system. Mol Syst Biol. 5: 317.
  • Nandi D, et al. (2006) The ubiquitin-proteasome system. Journal of biosciences. 31 (1): 137-55.
  • UBC9 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    UBC9 cDNA ORF Clone in Cloning Vector, Rat RG81167-U
    UBC9 cDNA ORF Clone, Rat, untagged RG81167-UT
    UBC9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81167-ACG
    UBC9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81167-ACGLN
    UBC9 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81167-ANG
    UBC9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81167-ACR
    UBC9 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81167-ANR
    UBC9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81167-CF
    UBC9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81167-NF
    UBC9 cDNA ORF Clone, Rat, C-His tag RG81167-CH
    UBC9 cDNA ORF Clone, Rat, N-His tag RG81167-NH
    UBC9 cDNA ORF Clone, Rat, C-HA tag RG81167-CY
    UBC9 cDNA ORF Clone, Rat, N-HA tag RG81167-NY
    UBC9 cDNA ORF Clone, Rat, C-Myc tag RG81167-CM
    UBC9 cDNA ORF Clone, Rat, N-Myc tag RG81167-NM
    UBC9 qPCR Primer Pairs, Rat RP301123

    UBC9 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    UBC9 cDNA ORF Clone in Cloning Vector, Mouse MG52988-G
    UBC9 cDNA ORF Clone, Mouse, untagged MG52988-UT
    UBC9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52988-ACGLN
    UBC9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52988-ACG
    UBC9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52988-ACR
    UBC9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52988-CF
    UBC9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52988-NF
    UBC9 cDNA ORF Clone, Mouse, C-His tag MG52988-CH
    UBC9 cDNA ORF Clone, Mouse, N-His tag MG52988-NH
    UBC9 cDNA ORF Clone, Mouse, C-HA tag MG52988-CY
    UBC9 cDNA ORF Clone, Mouse, N-HA tag MG52988-NY
    UBC9 cDNA ORF Clone, Mouse, N-Myc tag MG52988-NM

    UBC9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    UBC9 cDNA ORF Clone in Cloning Vector, Human HG13205-U
    UBC9 cDNA ORF Clone, Human, untagged HG13205-UT
    UBC9 cDNA ORF Clone, Human, C-GFPSpark® tag HG13205-ACG
    UBC9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13205-ACGLN
    UBC9 cDNA ORF Clone, Human, N-GFPSpark® tag HG13205-ANG
    UBC9 cDNA ORF Clone, Human, C-OFPSpark® tag HG13205-ACR
    UBC9 cDNA ORF Clone, Human, N-OFPSpark® tag HG13205-ANR
    UBC9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13205-CF
    UBC9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13205-NF
    UBC9 cDNA ORF Clone, Human, C-His tag HG13205-CH
    UBC9 cDNA ORF Clone, Human, N-His tag HG13205-NH
    UBC9 cDNA ORF Clone, Human, C-HA tag HG13205-CY
    UBC9 cDNA ORF Clone, Human, N-HA tag HG13205-NY
    UBC9 cDNA ORF Clone, Human, C-Myc tag HG13205-CM
    UBC9 cDNA ORF Clone, Human, N-Myc tag HG13205-NM
    info info
    添加购物车成功! 添加购物车失败!