Quick Order

Mouse UBE2D1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse UBE2D1 cDNA Clone Product Information
    NCBI RefSeq:NM_145420.2
    RefSeq ORF Size:444bp
    cDNA Description:Full length Clone DNA of Mus musculus ubiquitin-conjugating enzyme E2D 1.
    Gene Synonym:UBCH5
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with UBE2D1 qPCR primers for gene expression analysis, MP201358 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    References
  • Zhang L, et al. (2011) The IDOL-UBE2D complex mediates sterol-dependent degradation of the LDL receptor. Genes Dev. 25(12): 1262-74.
  • Tokumoto M, et al. (2011) Cadmium toxicity is caused by accumulation of p53 through the down-regulation of Ube2d family genes in vitro and in vivo. J Toxicol Sci. 36(2): 191-200.
  • Ohbayashi N, et al. (2008) Physical and functional interactions between ZIP kinase and UbcH5. Biochem Biophys Res Commun. 372(4): 708-12.
  • Gehrke SG, et al. (2003) UbcH5A, a member of human E2 ubiquitin-conjugating enzymes, is closely related to SFT, a stimulator of iron transport, and is up-regulated in hereditary hemochromatosis. Blood. 101(8): 3288-93.
  • Size / Price
    Catalog: MG51474-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"