After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse UBE2D1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse UBE2D1 cDNA Clone Product Information
NCBI RefSeq:NM_145420.2
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Mus musculus ubiquitin-conjugating enzyme E2D 1 with N terminal His tag.
Gene Synonym:UBCH5
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Zhang L, et al. (2011) The IDOL-UBE2D complex mediates sterol-dependent degradation of the LDL receptor. Genes Dev. 25(12): 1262-74.
  • Tokumoto M, et al. (2011) Cadmium toxicity is caused by accumulation of p53 through the down-regulation of Ube2d family genes in vitro and in vivo. J Toxicol Sci. 36(2): 191-200.
  • Ohbayashi N, et al. (2008) Physical and functional interactions between ZIP kinase and UbcH5. Biochem Biophys Res Commun. 372(4): 708-12.
  • Gehrke SG, et al. (2003) UbcH5A, a member of human E2 ubiquitin-conjugating enzymes, is closely related to SFT, a stimulator of iron transport, and is up-regulated in hereditary hemochromatosis. Blood. 101(8): 3288-93.
  • Size / Price
    Catalog: MG51474-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"