UBE2B cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51243-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UBE2B Reagents
CRO Services
Product recommended

All UBE2B Reagents
UBE2B cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Mouse ubiquitin-conjugating enzyme E2B with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBE2B cDNA ORF Clone, Mouse, C-HA tag Alternative Names
2610301N02Rik cDNA ORF Clone, Mouse;E2-14k cDNA ORF Clone, Mouse;HR6B cDNA ORF Clone, Mouse;mHR6B cDNA ORF Clone, Mouse;Rad6b cDNA ORF Clone, Mouse
UBE2B Background Information
Full Name
ubiquitin-conjugating enzyme E2B

UBE2B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBE2B cDNA ORF Clone in Cloning Vector, Rat RG83616-U
UBE2B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83616-ACGLN

UBE2B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBE2B cDNA ORF Clone in Cloning Vector, Mouse MG51243-U
UBE2B cDNA ORF Clone, Mouse, untagged MG51243-UT
UBE2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51243-ACG
UBE2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51243-ACGLN
UBE2B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51243-ANG
UBE2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51243-ACR
UBE2B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51243-ANR
UBE2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51243-CF
UBE2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51243-NF
UBE2B cDNA ORF Clone, Mouse, C-His tag MG51243-CH
UBE2B cDNA ORF Clone, Mouse, N-His tag MG51243-NH
UBE2B cDNA ORF Clone, Mouse, N-HA tag MG51243-NY
UBE2B cDNA ORF Clone, Mouse, C-Myc tag MG51243-CM
UBE2B cDNA ORF Clone, Mouse, N-Myc tag MG51243-NM
UBE2B qPCR Primer Pairs, Mouse MP201126

UBE2B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBE2B cDNA ORF Clone in Cloning Vector, Human HG16862-U
UBE2B cDNA ORF Clone, Human, untagged HG16862-UT
UBE2B cDNA ORF Clone, Human, C-GFPSpark® tag HG16862-ACG
UBE2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16862-ACGLN
UBE2B cDNA ORF Clone, Human, N-GFPSpark® tag HG16862-ANG
UBE2B cDNA ORF Clone, Human, C-OFPSpark® tag HG16862-ACR
UBE2B cDNA ORF Clone, Human, N-OFPSpark® tag HG16862-ANR
UBE2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16862-CF
UBE2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16862-NF
UBE2B cDNA ORF Clone, Human, C-His tag HG16862-CH
UBE2B cDNA ORF Clone, Human, N-His tag HG16862-NH
UBE2B cDNA ORF Clone, Human, C-HA tag HG16862-CY
UBE2B cDNA ORF Clone, Human, N-HA tag HG16862-NY
UBE2B cDNA ORF Clone, Human, C-Myc tag HG16862-CM
UBE2B cDNA ORF Clone, Human, N-Myc tag HG16862-NM
info info
添加购物车成功! 添加购物车失败!