UBALD1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52143-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBALD1 Reagents
CRO Services
Product recommended

All UBALD1 Reagents
UBALD1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Mouse UBA-like domain containing 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBALD1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1500031H01Rik cDNA ORF Clone, Mouse;BC013706 cDNA ORF Clone, Mouse;Fam100a cDNA ORF Clone, Mouse
UBALD1 Background Information
Full Name
UBA-like domain containing 1

UBALD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBALD1 cDNA ORF Clone in Cloning Vector, Mouse MG52143-G
UBALD1 cDNA ORF Clone, Mouse, untagged MG52143-UT
UBALD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52143-ACGLN
UBALD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52143-ACG
UBALD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52143-ANG
UBALD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52143-ACR
UBALD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52143-ANR
UBALD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52143-CF
UBALD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52143-NF
UBALD1 cDNA ORF Clone, Mouse, C-His tag MG52143-CH
UBALD1 cDNA ORF Clone, Mouse, N-His tag MG52143-NH
UBALD1 cDNA ORF Clone, Mouse, C-HA tag MG52143-CY
UBALD1 cDNA ORF Clone, Mouse, N-HA tag MG52143-NY
UBALD1 cDNA ORF Clone, Mouse, C-Myc tag MG52143-CM
UBALD1 qPCR Primer Pairs, Mouse MP202016

UBALD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBALD1 cDNA ORF Clone in Cloning Vector, Human HG27612-U
UBALD1 cDNA ORF Clone, Human, untagged HG27612-UT
UBALD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27612-ACGLN
UBALD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG27612-ACG
UBALD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG27612-ANG
UBALD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG27612-ACR
UBALD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG27612-ANR
UBALD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG27612-CF
UBALD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG27612-NF
UBALD1 cDNA ORF Clone, Human, C-His tag HG27612-CH
UBALD1 cDNA ORF Clone, Human, N-His tag HG27612-NH
UBALD1 cDNA ORF Clone, Human, C-HA tag HG27612-CY
UBALD1 cDNA ORF Clone, Human, N-HA tag HG27612-NY
UBALD1 cDNA ORF Clone, Human, C-Myc tag HG27612-CM
UBALD1 cDNA ORF Clone, Human, N-Myc tag HG27612-NM
info info
添加购物车成功! 添加购物车失败!