UBA52 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52833-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBA52 Reagents
CRO Services
Product recommended

All UBA52 Reagents
UBA52 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
426 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse ubiquitin A-52 residue ribosomal protein fusion product 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.43kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
UBA52 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBA52 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
UBA52 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
D8Ertd21e cDNA ORF Clone, Mouse;Gm1863 cDNA ORF Clone, Mouse;Rps27a cDNA ORF Clone, Mouse;Ubb cDNA ORF Clone, Mouse;Ubc cDNA ORF Clone, Mouse
UBA52 Background Information
Full Name
ubiquitin A-52 residue ribosomal protein fusion product 1

UBA52 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBA52 cDNA ORF Clone in Cloning Vector, Rat RG80808-U
UBA52 cDNA ORF Clone, Rat, untagged RG80808-UT
UBA52 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80808-ACG
UBA52 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80808-ACGLN
UBA52 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80808-ANG
UBA52 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80808-ACR
UBA52 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80808-ANR
UBA52 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80808-CF
UBA52 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80808-NF
UBA52 cDNA ORF Clone, Rat, C-His tag RG80808-CH
UBA52 cDNA ORF Clone, Rat, N-His tag RG80808-NH
UBA52 cDNA ORF Clone, Rat, C-HA tag RG80808-CY
UBA52 cDNA ORF Clone, Rat, N-HA tag RG80808-NY
UBA52 cDNA ORF Clone, Rat, C-Myc tag RG80808-CM
UBA52 cDNA ORF Clone, Rat, N-Myc tag RG80808-NM
UBA52 qPCR Primer Pairs, Rat RP300772

UBA52 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBA52 cDNA ORF Clone in Cloning Vector, Mouse MG52833-G
UBA52 cDNA ORF Clone, Mouse, untagged MG52833-UT
UBA52 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52833-ACG
UBA52 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52833-ACGLN
UBA52 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52833-ANG
UBA52 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52833-ACR
UBA52 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52833-ANR
UBA52 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52833-NF
UBA52 cDNA ORF Clone, Mouse, C-His tag MG52833-CH
UBA52 cDNA ORF Clone, Mouse, N-His tag MG52833-NH
UBA52 cDNA ORF Clone, Mouse, C-HA tag MG52833-CY
UBA52 cDNA ORF Clone, Mouse, N-HA tag MG52833-NY
UBA52 cDNA ORF Clone, Mouse, C-Myc tag MG52833-CM
UBA52 cDNA ORF Clone, Mouse, N-Myc tag MG52833-NM

UBA52 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBA52 cDNA ORF Clone in Cloning Vector, Human HG19262-U
UBA52 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19262-ACGLN
info info
添加购物车成功! 添加购物车失败!