Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50923-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Thymidine Phosphorylase Reagents
CRO Services
Product recommended

All Thymidine Phosphorylase Reagents
Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Mouse thymidine phosphorylase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2900072D10Rik cDNA ORF Clone, Mouse;Ecgf1 cDNA ORF Clone, Mouse;PD-ECGF cDNA ORF Clone, Mouse;PDECGF cDNA ORF Clone, Mouse;Pdgfec cDNA ORF Clone, Mouse
Thymidine Phosphorylase Background Information
Full Name
thymidine phosphorylase

Thymidine Phosphorylase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Thymidine Phosphorylase cDNA ORF Clone in Cloning Vector, Mouse MG50923-G
Thymidine Phosphorylase cDNA ORF Clone, Mouse, untagged MG50923-UT
Thymidine Phosphorylase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50923-ACGLN
Thymidine Phosphorylase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50923-ACG
Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50923-ANG
Thymidine Phosphorylase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50923-ACR
Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50923-ANR
Thymidine Phosphorylase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50923-CF
Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50923-NF
Thymidine Phosphorylase cDNA ORF Clone, Mouse, C-His tag MG50923-CH
Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-His tag MG50923-NH
Thymidine Phosphorylase cDNA ORF Clone, Mouse, C-HA tag MG50923-CY
Thymidine Phosphorylase cDNA ORF Clone, Mouse, N-HA tag MG50923-NY
Thymidine Phosphorylase cDNA ORF Clone, Mouse, C-Myc tag MG50923-CM
Thymidine Phosphorylase qPCR Primer Pairs, Mouse MP200892

Thymidine Phosphorylase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Thymidine Phosphorylase cDNA ORF Clone in Cloning Vector, Human HG10432-M
Thymidine Phosphorylase cDNA ORF Clone, Human, untagged HG10432-UT
Thymidine Phosphorylase cDNA ORF Clone, Human, C-GFPSpark® tag HG10432-ACG
Thymidine Phosphorylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10432-ACGLN
Thymidine Phosphorylase cDNA ORF Clone, Human, N-GFPSpark® tag HG10432-ANG
Thymidine Phosphorylase cDNA ORF Clone, Human, C-OFPSpark® tag HG10432-ACR
Thymidine Phosphorylase cDNA ORF Clone, Human, N-OFPSpark® tag HG10432-ANR
Thymidine Phosphorylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10432-CF
Thymidine Phosphorylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10432-NF
Thymidine Phosphorylase cDNA ORF Clone, Human, C-His tag HG10432-CH
Thymidine Phosphorylase cDNA ORF Clone, Human, N-His tag HG10432-NH
Thymidine Phosphorylase cDNA ORF Clone, Human, C-HA tag HG10432-CY
Thymidine Phosphorylase cDNA ORF Clone, Human, N-HA tag HG10432-NY
Thymidine Phosphorylase cDNA ORF Clone, Human, C-Myc tag HG10432-CM
Thymidine Phosphorylase cDNA ORF Clone, Human, N-Myc tag HG10432-NM
Thymidine Phosphorylase qPCR Primer Pairs, Human HP100462
info info
添加购物车成功! 添加购物车失败!