TXNL4A cDNA ORF Clone, Mouse, untagged

Cat: MG51571-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TXNL4A Reagents
CRO Services
Product recommended

All TXNL4A Reagents
TXNL4A cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
429 bp
Description
Full length Clone DNA of Mouse thioredoxin-like 4A.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TXNL4A cDNA ORF Clone, Mouse, untagged Alternative Names
D18Wsu98e cDNA ORF Clone, Mouse;Dim1 cDNA ORF Clone, Mouse;ENSMUSG00000057130 cDNA ORF Clone, Mouse;Txnl4 cDNA ORF Clone, Mouse;U5-15kD cDNA ORF Clone, Mouse;U5-15kDa cDNA ORF Clone, Mouse
TXNL4A Background Information

DIM1, also known as TXNL4A, is a member of the Dim protein family. The Dim protein family is composed of two classes, DIM1and Dim2, which share a common thioredoxin-like fold. They were originally identified for their role in cell cycle progression and have been found to interact with Prp6, an essential component of the spliceosome, which forms the bridge of U4/U6.U5-tri-snRNP. In spite of their biological and structural similarities, DIM1 and Dim2 proteins differ in many aspects. DIM1 bears distinctive structural motifs responsible for its interaction with other spliceosome components. Dim2 forms homodimers and contains specific domains required for its interactions with partners. This originality suggests that although both proteins are involved in pre-mRNA splicing, they are likely to be involved in different biological pathways. DIM1 interacts with HNRPF, HNRPH2, NEDD9/HEF1 and PQBP1/NPW38. It plays an essential role in pre-mRNA splicing.

Full Name
thioredoxin-like 4A
References
  • Zhang Y, et al. (2001) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1): 33-43.
  • Zhang YZ, et al. (2003) Structure, stability, and function of hDim1 investigated by NMR, circular dichroism, and mutational analysis. Biochemistry. 42(32):9609-18.
  • Zhang Y, et al. (2000) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1):33-43.
  • Zhang YZ, et al. (2000) The evolutionarily conserved Dim1 protein defines a novel branch of the thioredoxin fold superfamily. Physiol Genomics. 1(3):109-18.
  • info info
    添加购物车成功! 添加购物车失败!