Quick Order

Mouse DIM1/TXNL4A Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse TXNL4A cDNA Clone Product Information
    NCBI RefSeq:NM_025299.3
    RefSeq ORF Size:429bp
    cDNA Description:Full length Clone DNA of Mus musculus thioredoxin-like 4A with N terminal Myc tag.
    Gene Synonym:Dim1; Txnl4; U5-15kD; U5-15kDa; D18Wsu98e; ENSMUSG00000057130
    Species:Mouse
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TXNL4A qPCR primers for gene expression analysis, MP201454 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    DIM1, also known as TXNL4A, is a member of the Dim protein family. The Dim protein family is composed of two classes, DIM1and Dim2, which share a common thioredoxin-like fold. They were originally identified for their role in cell cycle progression and have been found to interact with Prp6, an essential component of the spliceosome, which forms the bridge of U4/U6.U5-tri-snRNP. In spite of their biological and structural similarities, DIM1 and Dim2 proteins differ in many aspects. DIM1 bears distinctive structural motifs responsible for its interaction with other spliceosome components. Dim2 forms homodimers and contains specific domains required for its interactions with partners. This originality suggests that although both proteins are involved in pre-mRNA splicing, they are likely to be involved in different biological pathways. DIM1 interacts with HNRPF, HNRPH2, NEDD9/HEF1 and PQBP1/NPW38. It plays an essential role in pre-mRNA splicing.

    References
  • Zhang Y, et al. (2001) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1): 33-43.
  • Zhang YZ, et al. (2003) Structure, stability, and function of hDim1 investigated by NMR, circular dichroism, and mutational analysis. Biochemistry. 42(32):9609-18.
  • Zhang Y, et al. (2000) Evidence that dim1 associates with proteins involved in pre-mRNA splicing, and delineation of residues essential for dim1 interactions with hnRNP F and Npw38/PQBP-1. Gene. 257 (1):33-43.
  • Zhang YZ, et al. (2000) The evolutionarily conserved Dim1 protein defines a novel branch of the thioredoxin fold superfamily. Physiol Genomics. 1(3):109-18.
  • Size / Price
    Catalog: MG51571-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"