TXNL1 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52411-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TXNL1 Reagents
CRO Services
Product recommended

All TXNL1 Reagents
TXNL1 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
870 bp
Description
Full length Clone DNA of Mouse thioredoxin-like 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TXNL1 cDNA ORF Clone, Mouse, C-His tag Alternative Names
32kDa cDNA ORF Clone, Mouse;TRP32 cDNA ORF Clone, Mouse;Txnl cDNA ORF Clone, Mouse
TXNL1 Background Information
Full Name
thioredoxin-like 1

TXNL1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TXNL1 cDNA ORF Clone in Cloning Vector, Rat RG86052-U
TXNL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86052-ACGLN

TXNL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TXNL1 cDNA ORF Clone in Cloning Vector, Mouse MG52411-G
TXNL1 cDNA ORF Clone, Mouse, untagged MG52411-UT
TXNL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52411-ACG
TXNL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52411-ACGLN
TXNL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52411-ANG
TXNL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52411-ACR
TXNL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52411-ANR
TXNL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52411-CF
TXNL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52411-NF
TXNL1 cDNA ORF Clone, Mouse, N-His tag MG52411-NH
TXNL1 cDNA ORF Clone, Mouse, C-HA tag MG52411-CY
TXNL1 cDNA ORF Clone, Mouse, N-HA tag MG52411-NY
TXNL1 cDNA ORF Clone, Mouse, C-Myc tag MG52411-CM
TXNL1 cDNA ORF Clone, Mouse, N-Myc tag MG52411-NM
TXNL1 qPCR Primer Pairs, Mouse MP202284

TXNL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TXNL1 cDNA ORF Clone in Cloning Vector, Human HG16663-U
TXNL1 cDNA ORF Clone, Human, untagged HG16663-UT
TXNL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16663-ACGLN
TXNL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16663-ACG
TXNL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16663-ANG
TXNL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16663-ACR
TXNL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16663-ANR
TXNL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16663-CF
TXNL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16663-NF
TXNL1 cDNA ORF Clone, Human, C-His tag HG16663-CH
TXNL1 cDNA ORF Clone, Human, N-His tag HG16663-NH
TXNL1 cDNA ORF Clone, Human, C-HA tag HG16663-CY
TXNL1 cDNA ORF Clone, Human, N-HA tag HG16663-NY
TXNL1 cDNA ORF Clone, Human, C-Myc tag HG16663-CM
TXNL1 cDNA ORF Clone, Human, N-Myc tag HG16663-NM
info info
添加购物车成功! 添加购物车失败!