TXNIP cDNA ORF Clone, Mouse, N-His tag

Cat: MG52103-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TXNIP Reagents
CRO Services
Product recommended

All TXNIP Reagents
TXNIP cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Mouse thioredoxin interacting protein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TXNIP cDNA ORF Clone, Mouse, N-His tag Alternative Names
1200008J08Rik cDNA ORF Clone, Mouse;AA682105 cDNA ORF Clone, Mouse;Hyplip1 cDNA ORF Clone, Mouse;Tbp-2 cDNA ORF Clone, Mouse;THIF cDNA ORF Clone, Mouse;VDUP1 cDNA ORF Clone, Mouse
TXNIP Background Information
Full Name
thioredoxin interacting protein

TXNIP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TXNIP cDNA ORF Clone in Cloning Vector, Rat RG82221-U
TXNIP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82221-ACGLN

TXNIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TXNIP cDNA ORF Clone in Cloning Vector, Mouse MG52103-G
TXNIP cDNA ORF Clone, Mouse, untagged MG52103-UT
TXNIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52103-ACGLN
TXNIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52103-ACG
TXNIP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52103-ANG
TXNIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52103-ACR
TXNIP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52103-ANR
TXNIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52103-CF
TXNIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52103-NF
TXNIP cDNA ORF Clone, Mouse, C-His tag MG52103-CH
TXNIP cDNA ORF Clone, Mouse, C-HA tag MG52103-CY
TXNIP cDNA ORF Clone, Mouse, N-HA tag MG52103-NY
TXNIP cDNA ORF Clone, Mouse, C-Myc tag MG52103-CM
TXNIP cDNA ORF Clone, Mouse, N-Myc tag MG52103-NM
TXNIP qPCR Primer Pairs, Mouse MP201976

TXNIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TXNIP cDNA ORF Clone in Cloning Vector, Human HG16553-G
TXNIP cDNA ORF Clone, Human, untagged HG16553-UT
TXNIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16553-ACGLN
TXNIP cDNA ORF Clone, Human, C-GFPSpark® tag HG16553-ACG
TXNIP cDNA ORF Clone, Human, N-GFPSpark® tag HG16553-ANG
TXNIP cDNA ORF Clone, Human, C-OFPSpark® tag HG16553-ACR
TXNIP cDNA ORF Clone, Human, N-OFPSpark® tag HG16553-ANR
TXNIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16553-CF
TXNIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16553-NF
TXNIP cDNA ORF Clone, Human, C-His tag HG16553-CH
TXNIP cDNA ORF Clone, Human, N-His tag HG16553-NH
TXNIP cDNA ORF Clone, Human, C-HA tag HG16553-CY
TXNIP cDNA ORF Clone, Human, N-HA tag HG16553-NY
TXNIP cDNA ORF Clone, Human, C-Myc tag HG16553-CM
TXNIP cDNA ORF Clone, Human, N-Myc tag HG16553-NM
info info
添加购物车成功! 添加购物车失败!