Quick Order

Text Size:AAA

Mouse TXNDC17 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse TXNDC17 cDNA Clone Product Information
NCBI RefSeq:NM_026559.3
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Mus musculus thioredoxin domain containing 17.
Gene Synonym:TRP14, Txnl5, D11Ertd672e, 4831443O22Rik, RP23-207N15.4
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Holmgren A. (1985) Thioredoxin. Annu Rev Biochem. 54: 237-71.
  • Holmgren A. (1995) Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 3 (3): 239-43.
  • Martin JL. (1995) Thioredoxin--a fold for all reasons. Structure. 3 (3): 245-50.
  • Size / Price
    Catalog: MG51578-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"