TXNDC12 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52557-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TXNDC12 Reagents
CRO Services
Product recommended

All TXNDC12 Reagents
TXNDC12 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
513 bp
Description
Full length Clone DNA of Mouse thioredoxin domain containing 12 (endoplasmic reticulum) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TXNDC12 cDNA ORF Clone, Mouse, N-His tag Alternative Names
0610040B21Rik cDNA ORF Clone, Mouse;ERp16 cDNA ORF Clone, Mouse;ERp19 cDNA ORF Clone, Mouse
TXNDC12 Background Information
Full Name
thioredoxin domain containing 12 (endoplasmic reticulum)

TXNDC12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TXNDC12 cDNA ORF Clone in Cloning Vector, Mouse MG52557-G
TXNDC12 cDNA ORF Clone, Mouse, untagged MG52557-UT
TXNDC12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52557-ACGLN
TXNDC12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52557-ACG
TXNDC12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52557-ACR
TXNDC12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52557-CF
TXNDC12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52557-NF
TXNDC12 cDNA ORF Clone, Mouse, C-His tag MG52557-CH
TXNDC12 cDNA ORF Clone, Mouse, C-HA tag MG52557-CY
TXNDC12 cDNA ORF Clone, Mouse, N-HA tag MG52557-NY
TXNDC12 cDNA ORF Clone, Mouse, C-Myc tag MG52557-CM
TXNDC12 cDNA ORF Clone, Mouse, N-Myc tag MG52557-NM
TXNDC12 qPCR Primer Pairs, Mouse MP202430

TXNDC12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TXNDC12 cDNA ORF Clone in Cloning Vector, Human HG16305-G
TXNDC12 cDNA ORF Clone, Human, untagged HG16305-UT
TXNDC12 cDNA ORF Clone, Human, C-GFPSpark® tag HG16305-ACG
TXNDC12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16305-ACGLN
TXNDC12 cDNA ORF Clone, Human, N-GFPSpark® tag HG16305-ANG
TXNDC12 cDNA ORF Clone, Human, C-OFPSpark® tag HG16305-ACR
TXNDC12 cDNA ORF Clone, Human, N-OFPSpark® tag HG16305-ANR
TXNDC12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16305-CF
TXNDC12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16305-NF
TXNDC12 cDNA ORF Clone, Human, C-His tag HG16305-CH
TXNDC12 cDNA ORF Clone, Human, N-His tag HG16305-NH
TXNDC12 cDNA ORF Clone, Human, C-HA tag HG16305-CY
TXNDC12 cDNA ORF Clone, Human, N-HA tag HG16305-NY
TXNDC12 cDNA ORF Clone, Human, C-Myc tag HG16305-CM
TXNDC12 cDNA ORF Clone, Human, N-Myc tag HG16305-NM
TXNDC12 qPCR Primer Pairs, Human HP105059
info info
添加购物车成功! 添加购物车失败!