Thioredoxin cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50822-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Thioredoxin Reagents
CRO Services
Product recommended

All Thioredoxin Reagents
Thioredoxin cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
318 bp
Description
Full length Clone DNA of Mouse thioredoxin 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thioredoxin cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Txn cDNA ORF Clone, Mouse;Txn1 cDNA ORF Clone, Mouse
Thioredoxin Background Information

Thioredoxin, also known as ATL-derived factor, Surface-associated sulphydryl protein, SASP and TXN, is a nucleus, cytoplasm and secreted protein which belongs to the thioredoxin family. Thioredoxins are proteins that act as antioxidants by facilitating the reduction of other proteins by cysteine thiol-disulfide exchange. Thioredoxins are found in nearly all known organisms and are essential for life in mammals. Thioredoxin / TXN participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions. Thioredoxin / TXN plays a role in the reversible S-nitrosylation of cysteine residues in target proteins, and thereby contributes to the response to intracellular nitric oxide. Thioredoxin / TXN nitrosylates the active site Cys of CASP3 in response to nitric oxide (NO), and thereby inhibits caspase-3 activity. Thioredoxin / TXN induces the FOS/JUN AP-1 DNA-binding activity in ionizing radiation (IR) cells through its oxidation/reduction status and stimulates AP-1 transcriptional activity.

Full Name
thioredoxin
References
  • Holmgren A , et al.,1989, J Biol Chem 264 (24): 13963-6.
  • Nordberg J, et al., 2001, Free Radic Biol Med31 (11): 1287-312.
  • Mustacich D, et al., 2000, Biochem J 346 (Pt 1): 1-8. 
  • Mitchell D.A., et al., 2005, Nat. Chem. Biol. 1:154-158.
  • Thioredoxin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Thioredoxin cDNA ORF Clone in Cloning Vector, Mouse MG50822-G
    Thioredoxin cDNA ORF Clone, Mouse, untagged MG50822-UT
    Thioredoxin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50822-ACG
    Thioredoxin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50822-ACGLN
    Thioredoxin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50822-ANG
    Thioredoxin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50822-ACR
    Thioredoxin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50822-ANR
    Thioredoxin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50822-CF
    Thioredoxin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50822-NF
    Thioredoxin cDNA ORF Clone, Mouse, C-His tag MG50822-CH
    Thioredoxin cDNA ORF Clone, Mouse, N-His tag MG50822-NH
    Thioredoxin cDNA ORF Clone, Mouse, C-HA tag MG50822-CY
    Thioredoxin cDNA ORF Clone, Mouse, N-HA tag MG50822-NY
    Thioredoxin cDNA ORF Clone, Mouse, C-Myc tag MG50822-CM
    Thioredoxin qPCR Primer Pairs, Mouse MP200793

    Thioredoxin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Thioredoxin cDNA ORF Clone in Cloning Vector, Human HG10384-M
    Thioredoxin cDNA ORF Clone, Human, untagged HG10384-UT
    Thioredoxin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10384-ACGLN
    Thioredoxin cDNA ORF Clone, Human, C-GFPSpark® tag HG10384-ACG
    Thioredoxin cDNA ORF Clone, Human, N-GFPSpark® tag HG10384-ANG
    Thioredoxin cDNA ORF Clone, Human, C-OFPSpark® tag HG10384-ACR
    Thioredoxin cDNA ORF Clone, Human, N-OFPSpark® tag HG10384-ANR
    Thioredoxin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10384-CF
    Thioredoxin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10384-NF
    Thioredoxin cDNA ORF Clone, Human, C-His tag HG10384-CH
    Thioredoxin cDNA ORF Clone, Human, N-His tag HG10384-NH
    Thioredoxin cDNA ORF Clone, Human, C-HA tag HG10384-CY
    Thioredoxin cDNA ORF Clone, Human, N-HA tag HG10384-NY
    Thioredoxin cDNA ORF Clone, Human, C-Myc tag HG10384-CM
    Thioredoxin cDNA ORF Clone, Human, N-Myc tag HG10384-NM
    Thioredoxin qPCR Primer Pairs, Human HP100418
    info info
    添加购物车成功! 添加购物车失败!