TWSG1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50162-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TWSG1 Reagents
CRO Services
Product recommended

All TWSG1 Reagents
TWSG1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
669 bp
Description
Full length Clone DNA of Mouse twisted gastrulation homolog 1 (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TWSG1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1810013J15Rik cDNA ORF Clone, Mouse;9030422N06Rik cDNA ORF Clone, Mouse;AW552143 cDNA ORF Clone, Mouse;D17Ertd403e cDNA ORF Clone, Mouse;Tsg cDNA ORF Clone, Mouse;Twg cDNA ORF Clone, Mouse
TWSG1 Background Information

TWSG1 belongs to the twisted gastrulation protein family. TWSG1 from different species are functionally equivalent. In contrast to Drosophila where TWSG1 expression is limited to early embryos, expression of TWSG1 is found throughout mouse and human development. Mutations in the TWSG1 gene cause at least some of the cells on the dorsal half of the embryo to adopt more ventral cell fates. This is thought to involve gradients of the signaling molecule decapentaplegic. TWSG1 may function as a bone morphogenetic protein signalling agonist or antagonize these activities. It can dislodge latent bone morphogenetic proteins and thus provides a permissive signal that allows high BMP signaling in the embryo. TWSG1 is a cofactor in the antagonism of chordin to BMP signaling. It also binds both the vertebrate Decapentaplegic ortholog BMP4 and chordin and forms ternary complexes. Meanwhile, TWSG1 increases binding of chordin to BMP4, potentiates the ability of chordin to induce secondary axes in Xenopus embryos, and enhances chordin cleavage by vertebrate proteases related to tolloid at a site poorly used in the absence of TWSG1. The presence of TWSG1 enhances the secondary axis-inducing activity of 2 products of chordin cleavage.

Full Name
twisted gastrulation homolog 1 (Drosophila)
References
  • Tzachanis D, et al. (2007) Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-beta signaling in activated T lymphocytes. J Immunol. Blood. 109 (7): 2944-52.
  • Tanno T, et al. (2009) Identification of TWSG1 as a second novel erythroid regulator of hepcidin expression in murine and human cells. Blood. 114 (1): 181-6.
  • Kauvar EF, et al. (2011) Minimal evidence for a direct involvement of twisted gastrulation homolog 1 (TWSG1) gene in human holoprosencephaly. Mol Genet Metab. 102 (4): 470-80.
  • info info
    添加购物车成功! 添加购物车失败!