After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse TWSG1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse TWSG1 cDNA Clone Product Information
NCBI RefSeq:NM_023053.2
RefSeq ORF Size:669bp
cDNA Description:Full length Clone DNA of Mus musculus twisted gastrulation homolog 1 (Drosophila) with N terminal His tag.
Gene Synonym:Tsg, Twg, AW552143, D17Ertd403e, 1810013J15Rik, 9030422N06Rik, Twsg1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

TWSG1 belongs to the twisted gastrulation protein family. TWSG1 from different species are functionally equivalent. In contrast to Drosophila where TWSG1 expression is limited to early embryos, expression of TWSG1 is found throughout mouse and human development. Mutations in the TWSG1 gene cause at least some of the cells on the dorsal half of the embryo to adopt more ventral cell fates. This is thought to involve gradients of the signaling molecule decapentaplegic. TWSG1 may function as a bone morphogenetic protein signalling agonist or antagonize these activities. It can dislodge latent bone morphogenetic proteins and thus provides a permissive signal that allows high BMP signaling in the embryo. TWSG1 is a cofactor in the antagonism of chordin to BMP signaling. It also binds both the vertebrate Decapentaplegic ortholog BMP4 and chordin and forms ternary complexes. Meanwhile, TWSG1 increases binding of chordin to BMP4, potentiates the ability of chordin to induce secondary axes in Xenopus embryos, and enhances chordin cleavage by vertebrate proteases related to tolloid at a site poorly used in the absence of TWSG1. The presence of TWSG1 enhances the secondary axis-inducing activity of 2 products of chordin cleavage.

References
  • Tzachanis D, et al. (2007) Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-beta signaling in activated T lymphocytes. J Immunol. Blood. 109 (7): 2944-52.
  • Tanno T, et al. (2009) Identification of TWSG1 as a second novel erythroid regulator of hepcidin expression in murine and human cells. Blood. 114 (1): 181-6.
  • Kauvar EF, et al. (2011) Minimal evidence for a direct involvement of twisted gastrulation homolog 1 (TWSG1) gene in human holoprosencephaly. Mol Genet Metab. 102 (4): 470-80.
  • Size / Price
    Catalog: MG50162-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"