TWF2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50884-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TWF2 Reagents
CRO Services
Product recommended

All TWF2 Reagents
TWF2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Mouse twinfilin, actin-binding protein, homolog 2 (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TWF2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
A6-related cDNA ORF Clone, Mouse;AU014993 cDNA ORF Clone, Mouse;Ptk9l cDNA ORF Clone, Mouse;Ptk9r cDNA ORF Clone, Mouse
TWF2 Background Information
Full Name
twinfilin, actin-binding protein, homolog 2 (Drosophila)

TWF2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TWF2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90753-G
TWF2 cDNA ORF Clone, Cynomolgus, untagged CG90753-UT
TWF2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90753-ACG
TWF2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90753-ACGLN
TWF2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90753-ANG
TWF2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90753-ACR
TWF2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90753-ANR
TWF2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90753-CF
TWF2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90753-NF
TWF2 cDNA ORF Clone, Cynomolgus, C-His tag CG90753-CH
TWF2 cDNA ORF Clone, Cynomolgus, N-His tag CG90753-NH
TWF2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90753-CY
TWF2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90753-NY
TWF2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90753-CM
TWF2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90753-NM

TWF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TWF2 cDNA ORF Clone in Cloning Vector, Mouse MG50884-G
TWF2 cDNA ORF Clone, Mouse, untagged MG50884-UT
TWF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50884-ACGLN
TWF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50884-ACG
TWF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50884-ANG
TWF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50884-ACR
TWF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50884-ANR
TWF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50884-CF
TWF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50884-NF
TWF2 cDNA ORF Clone, Mouse, C-His tag MG50884-CH
TWF2 cDNA ORF Clone, Mouse, C-HA tag MG50884-CY
TWF2 cDNA ORF Clone, Mouse, N-HA tag MG50884-NY
TWF2 cDNA ORF Clone, Mouse, C-Myc tag MG50884-CM
TWF2 cDNA ORF Clone, Mouse, N-Myc tag MG50884-NM
TWF2 qPCR Primer Pairs, Mouse MP200855

TWF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TWF2 cDNA ORF Clone in Cloning Vector, Human HG10724-M
TWF2 cDNA ORF Clone, Human, untagged HG10724-UT
TWF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10724-ACG
TWF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10724-ACGLN
TWF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10724-ANG
TWF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10724-ACR
TWF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10724-ANR
TWF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10724-CF
TWF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10724-NF
TWF2 cDNA ORF Clone, Human, C-His tag HG10724-CH
TWF2 cDNA ORF Clone, Human, N-His tag HG10724-NH
TWF2 cDNA ORF Clone, Human, C-HA tag HG10724-CY
TWF2 cDNA ORF Clone, Human, N-HA tag HG10724-NY
TWF2 cDNA ORF Clone, Human, C-Myc tag HG10724-CM
TWF2 cDNA ORF Clone, Human, N-Myc tag HG10724-NM
TWF2 qPCR Primer Pairs, Human HP100663
info info
添加购物车成功! 添加购物车失败!