TUSC2 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52360-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUSC2 Reagents
CRO Services
Product recommended

All TUSC2 Reagents
TUSC2 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
333 bp
Description
Full length Clone DNA of Mouse tumor suppressor candidate 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUSC2 cDNA ORF Clone, Mouse, C-His tag Alternative Names
1190001E22Rik cDNA ORF Clone, Mouse;AA407686 cDNA ORF Clone, Mouse;Fus1 cDNA ORF Clone, Mouse;Lgcc cDNA ORF Clone, Mouse;PAP cDNA ORF Clone, Mouse;Pdap2 cDNA ORF Clone, Mouse
TUSC2 Background Information
Full Name
tumor suppressor candidate 2

TUSC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TUSC2 cDNA ORF Clone in Cloning Vector, Rat RG89370-U
TUSC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89370-ACGLN

TUSC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUSC2 cDNA ORF Clone in Cloning Vector, Mouse MG52360-G
TUSC2 cDNA ORF Clone, Mouse, untagged MG52360-UT
TUSC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52360-ACGLN
TUSC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52360-ACG
TUSC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52360-ANG
TUSC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52360-ACR
TUSC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52360-ANR
TUSC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52360-CF
TUSC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52360-NF
TUSC2 cDNA ORF Clone, Mouse, N-His tag MG52360-NH
TUSC2 cDNA ORF Clone, Mouse, C-HA tag MG52360-CY
TUSC2 cDNA ORF Clone, Mouse, N-HA tag MG52360-NY
TUSC2 cDNA ORF Clone, Mouse, C-Myc tag MG52360-CM
TUSC2 cDNA ORF Clone, Mouse, N-Myc tag MG52360-NM
TUSC2 qPCR Primer Pairs, Mouse MP202233

TUSC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUSC2 cDNA ORF Clone in Cloning Vector, Human HG15406-G
TUSC2 cDNA ORF Clone, Human, untagged HG15406-UT
TUSC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15406-ACG
TUSC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15406-ACGLN
TUSC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15406-ANG
TUSC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15406-ACR
TUSC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15406-ANR
TUSC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15406-CF
TUSC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15406-NF
TUSC2 cDNA ORF Clone, Human, C-His tag HG15406-CH
TUSC2 cDNA ORF Clone, Human, N-His tag HG15406-NH
TUSC2 cDNA ORF Clone, Human, C-HA tag HG15406-CY
TUSC2 cDNA ORF Clone, Human, N-HA tag HG15406-NY
TUSC2 cDNA ORF Clone, Human, C-Myc tag HG15406-CM
TUSC2 cDNA ORF Clone, Human, N-Myc tag HG15406-NM
TUSC2 qPCR Primer Pairs, Human HP104030
info info
添加购物车成功! 添加购物车失败!