TUBB5 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52582-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TUBB5 Reagents

CRO Services

Product recommended


All TUBB5 Reagents

TUBB5 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Description
Full length Clone DNA of Mouse tubulin, beta 5 class I with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBB5 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

AA408537 cDNA ORF Clone, Mouse;AI596182 cDNA ORF Clone, Mouse;B130022C14Rik cDNA ORF Clone, Mouse;M(beta)5 cDNA ORF Clone, Mouse

TUBB5 Background Information

Full Name
tubulin, beta 5 class I

TUBB5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TUBB5 cDNA ORF Clone in Cloning Vector, Rat RG80682-U
TUBB5 cDNA ORF Clone, Rat, untagged RG80682-UT
TUBB5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80682-ACG
TUBB5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80682-ACGLN
TUBB5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80682-ANG
TUBB5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80682-ACR
TUBB5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80682-ANR
TUBB5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80682-CF
TUBB5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80682-NF
TUBB5 cDNA ORF Clone, Rat, C-His tag RG80682-CH
TUBB5 cDNA ORF Clone, Rat, N-His tag RG80682-NH
TUBB5 cDNA ORF Clone, Rat, C-HA tag RG80682-CY
TUBB5 cDNA ORF Clone, Rat, N-HA tag RG80682-NY
TUBB5 cDNA ORF Clone, Rat, C-Myc tag RG80682-CM
TUBB5 cDNA ORF Clone, Rat, N-Myc tag RG80682-NM
TUBB5 qPCR Primer Pairs, Rat RP300646

TUBB5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBB5 cDNA ORF Clone in Cloning Vector, Mouse MG52582-G
TUBB5 cDNA ORF Clone, Mouse, untagged MG52582-UT
TUBB5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52582-ACGLN
TUBB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52582-ACG
TUBB5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52582-ANG
TUBB5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52582-ACR
TUBB5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52582-ANR
TUBB5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52582-CF
TUBB5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52582-NF
TUBB5 cDNA ORF Clone, Mouse, C-His tag MG52582-CH
TUBB5 cDNA ORF Clone, Mouse, N-His tag MG52582-NH
TUBB5 cDNA ORF Clone, Mouse, C-HA tag MG52582-CY
TUBB5 cDNA ORF Clone, Mouse, N-HA tag MG52582-NY
TUBB5 cDNA ORF Clone, Mouse, C-Myc tag MG52582-CM
TUBB5 qPCR Primer Pairs, Mouse MP202453
info info
添加购物车成功! 添加购物车失败!