TUBB4B cDNA ORF Clone, Mouse, N-His tag

Cat: MG51424-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TUBB4B Reagents
CRO Services
Product recommended

All TUBB4B Reagents
TUBB4B cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1338 bp
Description
Full length Clone DNA of Mouse tubulin, beta 4B class IVB with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBB4B cDNA ORF Clone, Mouse, N-His tag Alternative Names
4930542G03Rik cDNA ORF Clone, Mouse;Tubb2c cDNA ORF Clone, Mouse;Tubb2c1 cDNA ORF Clone, Mouse
TUBB4B Background Information
Full Name
tubulin, beta 4B class IVb

TUBB4B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TUBB4B cDNA ORF Clone in Cloning Vector, Rat RG86811-U
TUBB4B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86811-ACGLN

TUBB4B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBB4B cDNA ORF Clone in Cloning Vector, Mouse MG51424-G
TUBB4B cDNA ORF Clone, Mouse, untagged MG51424-UT
TUBB4B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51424-ACGLN
TUBB4B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51424-ACG
TUBB4B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51424-ANG
TUBB4B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51424-ACR
TUBB4B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51424-ANR
TUBB4B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51424-CF
TUBB4B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51424-NF
TUBB4B cDNA ORF Clone, Mouse, C-His tag MG51424-CH
TUBB4B cDNA ORF Clone, Mouse, C-HA tag MG51424-CY
TUBB4B cDNA ORF Clone, Mouse, N-HA tag MG51424-NY
TUBB4B cDNA ORF Clone, Mouse, C-Myc tag MG51424-CM
TUBB4B cDNA ORF Clone, Mouse, N-Myc tag MG51424-NM
TUBB4B qPCR Primer Pairs, Mouse MP201308

TUBB4B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUBB4B cDNA ORF Clone in Cloning Vector, Human HG14904-G
TUBB4B cDNA ORF Clone, Human, untagged HG14904-UT
TUBB4B cDNA ORF Clone, Human, C-GFPSpark® tag HG14904-ACG
TUBB4B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14904-ACGLN
TUBB4B cDNA ORF Clone, Human, N-GFPSpark® tag HG14904-ANG
TUBB4B cDNA ORF Clone, Human, C-OFPSpark® tag HG14904-ACR
TUBB4B cDNA ORF Clone, Human, N-OFPSpark® tag HG14904-ANR
TUBB4B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14904-CF
TUBB4B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14904-NF
TUBB4B cDNA ORF Clone, Human, C-His tag HG14904-CH
TUBB4B cDNA ORF Clone, Human, N-His tag HG14904-NH
TUBB4B cDNA ORF Clone, Human, C-HA tag HG14904-CY
TUBB4B cDNA ORF Clone, Human, N-HA tag HG14904-NY
TUBB4B cDNA ORF Clone, Human, C-Myc tag HG14904-CM
TUBB4B cDNA ORF Clone, Human, N-Myc tag HG14904-NM
TUBB4B qPCR Primer Pairs, Human HP103533
info info
添加购物车成功! 添加购物车失败!