TUBA4A cDNA ORF Clone, Mouse, untagged

Cat: MG51401-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUBA4A Reagents
CRO Services
Product recommended

All TUBA4A Reagents
TUBA4A cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1347 bp
Description
Full length Clone DNA of Mouse tubulin, alpha 4A.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBA4A cDNA ORF Clone, Mouse, untagged Alternative Names
M[a]4 cDNA ORF Clone, Mouse;Tuba4 cDNA ORF Clone, Mouse
TUBA4A Background Information
Full Name
tubulin, alpha 4a

TUBA4A cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TUBA4A cDNA ORF Clone in Cloning Vector, Cynomolgus CG90788-G
TUBA4A cDNA ORF Clone, Cynomolgus, untagged CG90788-UT
TUBA4A cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90788-ACG
TUBA4A Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90788-ACGLN
TUBA4A cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90788-ANG
TUBA4A cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90788-ACR
TUBA4A cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90788-ANR
TUBA4A cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90788-CF
TUBA4A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90788-NF
TUBA4A cDNA ORF Clone, Cynomolgus, C-His tag CG90788-CH
TUBA4A cDNA ORF Clone, Cynomolgus, N-His tag CG90788-NH
TUBA4A cDNA ORF Clone, Cynomolgus, C-HA tag CG90788-CY
TUBA4A cDNA ORF Clone, Cynomolgus, N-HA tag CG90788-NY
TUBA4A cDNA ORF Clone, Cynomolgus, C-Myc tag CG90788-CM
TUBA4A cDNA ORF Clone, Cynomolgus, N-Myc tag CG90788-NM

TUBA4A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBA4A cDNA ORF Clone in Cloning Vector, Mouse MG51401-U
TUBA4A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51401-ACGLN
TUBA4A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51401-ACG
TUBA4A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51401-ANG
TUBA4A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51401-ACR
TUBA4A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51401-ANR
TUBA4A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51401-CF
TUBA4A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51401-NF
TUBA4A cDNA ORF Clone, Mouse, C-His tag MG51401-CH
TUBA4A cDNA ORF Clone, Mouse, N-His tag MG51401-NH
TUBA4A cDNA ORF Clone, Mouse, C-HA tag MG51401-CY
TUBA4A cDNA ORF Clone, Mouse, N-HA tag MG51401-NY
TUBA4A cDNA ORF Clone, Mouse, C-Myc tag MG51401-CM
TUBA4A cDNA ORF Clone, Mouse, N-Myc tag MG51401-NM
TUBA4A qPCR Primer Pairs, Mouse MP201271

TUBA4A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUBA4A cDNA ORF Clone in Cloning Vector, Human HG14067-G
TUBA4A cDNA ORF Clone, Human, untagged HG14067-UT
TUBA4A cDNA ORF Clone, Human, C-GFPSpark® tag HG14067-ACG
TUBA4A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14067-ACGLN
TUBA4A cDNA ORF Clone, Human, N-GFPSpark® tag HG14067-ANG
TUBA4A cDNA ORF Clone, Human, C-OFPSpark® tag HG14067-ACR
TUBA4A cDNA ORF Clone, Human, N-OFPSpark® tag HG14067-ANR
TUBA4A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14067-CF
TUBA4A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14067-NF
TUBA4A cDNA ORF Clone, Human, C-His tag HG14067-CH
TUBA4A cDNA ORF Clone, Human, N-His tag HG14067-NH
TUBA4A cDNA ORF Clone, Human, C-HA tag HG14067-CY
TUBA4A cDNA ORF Clone, Human, N-HA tag HG14067-NY
TUBA4A cDNA ORF Clone, Human, C-Myc tag HG14067-CM
TUBA4A cDNA ORF Clone, Human, N-Myc tag HG14067-NM
TUBA4A qPCR Primer Pairs, Human HP102723
info info
添加购物车成功! 添加购物车失败!