TTC8 cDNA ORF Clone, Mouse, untagged

Cat: MG51600-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TTC8 Reagents
CRO Services
Product recommended

All TTC8 Reagents
TTC8 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Description
Full length Clone DNA of Mouse tetratricopeptide repeat domain 8.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TTC8 cDNA ORF Clone, Mouse, untagged Alternative Names
0610012F22Rik cDNA ORF Clone, Mouse;AV001447 cDNA ORF Clone, Mouse;BBS8 cDNA ORF Clone, Mouse
TTC8 Background Information
Full Name
tetratricopeptide repeat domain 8

TTC8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TTC8 cDNA ORF Clone in Cloning Vector, Mouse MG51600-G
TTC8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51600-ACGLN
TTC8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51600-ACG
TTC8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51600-ANG
TTC8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51600-ACR
TTC8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51600-ANR
TTC8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51600-CF
TTC8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51600-NF
TTC8 cDNA ORF Clone, Mouse, C-His tag MG51600-CH
TTC8 cDNA ORF Clone, Mouse, N-His tag MG51600-NH
TTC8 cDNA ORF Clone, Mouse, C-HA tag MG51600-CY
TTC8 cDNA ORF Clone, Mouse, N-HA tag MG51600-NY
TTC8 cDNA ORF Clone, Mouse, C-Myc tag MG51600-CM
TTC8 cDNA ORF Clone, Mouse, N-Myc tag MG51600-NM
TTC8 qPCR Primer Pairs, Mouse MP201483

TTC8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TTC8 cDNA ORF Clone in Cloning Vector, Human HG16822-U
TTC8 cDNA ORF Clone, Human, untagged HG16822-UT
TTC8 cDNA ORF Clone, Human, C-GFPSpark® tag HG16822-ACG
TTC8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16822-ACGLN
TTC8 cDNA ORF Clone, Human, N-GFPSpark® tag HG16822-ANG
TTC8 cDNA ORF Clone, Human, C-OFPSpark® tag HG16822-ACR
TTC8 cDNA ORF Clone, Human, N-OFPSpark® tag HG16822-ANR
TTC8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16822-CF
TTC8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16822-NF
TTC8 cDNA ORF Clone, Human, C-His tag HG16822-CH
TTC8 cDNA ORF Clone, Human, N-His tag HG16822-NH
TTC8 cDNA ORF Clone, Human, C-HA tag HG16822-CY
TTC8 cDNA ORF Clone, Human, N-HA tag HG16822-NY
TTC8 cDNA ORF Clone, Human, C-Myc tag HG16822-CM
TTC8 cDNA ORF Clone, Human, N-Myc tag HG16822-NM
info info
添加购物车成功! 添加购物车失败!