TTC27 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51896-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TTC27 Reagents
CRO Services
Product recommended

All TTC27 Reagents
TTC27 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2544 bp
Description
Full length Clone DNA of Mouse tetratricopeptide repeat domain 27 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TTC27 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2610511O17Rik cDNA ORF Clone, Mouse
TTC27 Background Information
Full Name
tetratricopeptide repeat domain 27

TTC27 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TTC27 cDNA ORF Clone in Cloning Vector, Mouse MG51896-G
TTC27 cDNA ORF Clone, Mouse, untagged MG51896-UT
TTC27 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51896-ACG
TTC27 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51896-ACGLN
TTC27 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51896-ANG
TTC27 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51896-ACR
TTC27 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51896-ANR
TTC27 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51896-CF
TTC27 cDNA ORF Clone, Mouse, C-His tag MG51896-CH
TTC27 cDNA ORF Clone, Mouse, N-His tag MG51896-NH
TTC27 cDNA ORF Clone, Mouse, C-HA tag MG51896-CY
TTC27 cDNA ORF Clone, Mouse, N-HA tag MG51896-NY
TTC27 cDNA ORF Clone, Mouse, C-Myc tag MG51896-CM
TTC27 cDNA ORF Clone, Mouse, N-Myc tag MG51896-NM
TTC27 qPCR Primer Pairs, Mouse MP201769

TTC27 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TTC27 cDNA ORF Clone in Cloning Vector, Human HG16308-G
TTC27 cDNA ORF Clone, Human, untagged HG16308-UT
TTC27 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16308-ACGLN
TTC27 cDNA ORF Clone, Human, C-GFPSpark® tag HG16308-ACG
TTC27 cDNA ORF Clone, Human, N-GFPSpark® tag HG16308-ANG
TTC27 cDNA ORF Clone, Human, C-OFPSpark® tag HG16308-ACR
TTC27 cDNA ORF Clone, Human, N-OFPSpark® tag HG16308-ANR
TTC27 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16308-CF
TTC27 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16308-NF
TTC27 cDNA ORF Clone, Human, C-His tag HG16308-CH
TTC27 cDNA ORF Clone, Human, N-His tag HG16308-NH
TTC27 cDNA ORF Clone, Human, C-HA tag HG16308-CY
TTC27 cDNA ORF Clone, Human, N-HA tag HG16308-NY
TTC27 cDNA ORF Clone, Human, C-Myc tag HG16308-CM
TTC27 cDNA ORF Clone, Human, N-Myc tag HG16308-NM
TTC27 qPCR Primer Pairs, Human HP105062
info info
添加购物车成功! 添加购物车失败!