TSSC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52259-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TSSC1 Reagents
CRO Services
Product recommended

All TSSC1 Reagents
TSSC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1161 bp
Description
Full length Clone DNA of Mouse tumor suppressing subtransferable candidate 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TSSC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
D12Ertd604e cDNA ORF Clone, Mouse
TSSC1 Background Information
Full Name
tumor suppressing subtransferable candidate 1

TSSC1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TSSC1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90838-G
TSSC1 cDNA ORF Clone, Cynomolgus, untagged CG90838-UT
TSSC1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90838-ACGLN
TSSC1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90838-ACG
TSSC1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90838-ANG
TSSC1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90838-ACR
TSSC1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90838-ANR
TSSC1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90838-CF
TSSC1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90838-NF
TSSC1 cDNA ORF Clone, Cynomolgus, C-His tag CG90838-CH
TSSC1 cDNA ORF Clone, Cynomolgus, N-His tag CG90838-NH
TSSC1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90838-CY
TSSC1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90838-NY
TSSC1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90838-CM
TSSC1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90838-NM

TSSC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TSSC1 cDNA ORF Clone in Cloning Vector, Mouse MG52259-G
TSSC1 cDNA ORF Clone, Mouse, untagged MG52259-UT
TSSC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52259-ACGLN
TSSC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52259-ACG
TSSC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52259-ANG
TSSC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52259-ACR
TSSC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52259-ANR
TSSC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52259-NF
TSSC1 cDNA ORF Clone, Mouse, C-His tag MG52259-CH
TSSC1 cDNA ORF Clone, Mouse, N-His tag MG52259-NH
TSSC1 cDNA ORF Clone, Mouse, C-HA tag MG52259-CY
TSSC1 cDNA ORF Clone, Mouse, N-HA tag MG52259-NY
TSSC1 cDNA ORF Clone, Mouse, C-Myc tag MG52259-CM
TSSC1 cDNA ORF Clone, Mouse, N-Myc tag MG52259-NM
TSSC1 qPCR Primer Pairs, Mouse MP202132

TSSC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TSSC1 cDNA ORF Clone, Human, untagged HG16536-UT
TSSC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16536-ACGLN
TSSC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16536-ACG
TSSC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16536-ANG
TSSC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16536-ACR
TSSC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16536-ANR
TSSC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16536-CF
TSSC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16536-NF
TSSC1 cDNA ORF Clone, Human, C-His tag HG16536-CH
TSSC1 cDNA ORF Clone, Human, N-His tag HG16536-NH
TSSC1 cDNA ORF Clone, Human, C-HA tag HG16536-CY
TSSC1 cDNA ORF Clone, Human, N-HA tag HG16536-NY
TSSC1 cDNA ORF Clone, Human, C-Myc tag HG16536-CM
TSSC1 cDNA ORF Clone, Human, N-Myc tag HG16536-NM
info info
添加购物车成功! 添加购物车失败!