TSPAN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52258-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TSPAN3 Reagents
CRO Services
Product recommended

All TSPAN3 Reagents
TSPAN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
762 bp
Description
Full length Clone DNA of Mouse tetraspanin 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TSPAN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1700055K04Rik cDNA ORF Clone, Mouse;TM4-A cDNA ORF Clone, Mouse;Tm4sf8 cDNA ORF Clone, Mouse
TSPAN3 Background Information
Full Name
tetraspanin 3

TSPAN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TSPAN3 cDNA ORF Clone in Cloning Vector, Mouse MG52258-U
TSPAN3 cDNA ORF Clone, Mouse, untagged MG52258-UT
TSPAN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52258-ACGLN
TSPAN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52258-ACG
TSPAN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52258-ANG
TSPAN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52258-ACR
TSPAN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52258-ANR
TSPAN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52258-NF
TSPAN3 cDNA ORF Clone, Mouse, C-His tag MG52258-CH
TSPAN3 cDNA ORF Clone, Mouse, N-His tag MG52258-NH
TSPAN3 cDNA ORF Clone, Mouse, C-HA tag MG52258-CY
TSPAN3 cDNA ORF Clone, Mouse, N-HA tag MG52258-NY
TSPAN3 cDNA ORF Clone, Mouse, C-Myc tag MG52258-CM
TSPAN3 cDNA ORF Clone, Mouse, N-Myc tag MG52258-NM
TSPAN3 qPCR Primer Pairs, Mouse MP202131

TSPAN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TSPAN3 cDNA ORF Clone in Cloning Vector, Human HG14032-G
TSPAN3 cDNA ORF Clone, Human, untagged HG14032-UT
TSPAN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14032-ACG
TSPAN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14032-ACGLN
TSPAN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14032-ACR
TSPAN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14032-CF
TSPAN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14032-NF
TSPAN3 cDNA ORF Clone, Human, C-His tag HG14032-CH
TSPAN3 cDNA ORF Clone, Human, N-His tag HG14032-NH
TSPAN3 cDNA ORF Clone, Human, C-HA tag HG14032-CY
TSPAN3 cDNA ORF Clone, Human, N-HA tag HG14032-NY
TSPAN3 cDNA ORF Clone, Human, C-Myc tag HG14032-CM
TSPAN3 cDNA ORF Clone, Human, N-Myc tag HG14032-NM
TSPAN3 qPCR Primer Pairs, Human HP102688
info info
添加购物车成功! 添加购物车失败!