TSPAN13 cDNA ORF Clone, Mouse, untagged

Cat: MG52575-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TSPAN13 Reagents
CRO Services
Product recommended

All TSPAN13 Reagents
TSPAN13 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
615 bp
Description
Full length Clone DNA of Mouse tetraspanin 13.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TSPAN13 cDNA ORF Clone, Mouse, untagged Alternative Names
1100001I23Rik cDNA ORF Clone, Mouse;NET-6 cDNA ORF Clone, Mouse;Tm4sf13 cDNA ORF Clone, Mouse
TSPAN13 Background Information
Full Name
tetraspanin 13

TSPAN13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TSPAN13 cDNA ORF Clone in Cloning Vector, Mouse MG52575-G
TSPAN13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52575-ACG
TSPAN13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52575-ACGLN
TSPAN13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52575-ACR
TSPAN13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52575-CF
TSPAN13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52575-NF
TSPAN13 cDNA ORF Clone, Mouse, C-His tag MG52575-CH
TSPAN13 cDNA ORF Clone, Mouse, N-His tag MG52575-NH
TSPAN13 cDNA ORF Clone, Mouse, C-HA tag MG52575-CY
TSPAN13 cDNA ORF Clone, Mouse, N-HA tag MG52575-NY
TSPAN13 cDNA ORF Clone, Mouse, C-Myc tag MG52575-CM
TSPAN13 cDNA ORF Clone, Mouse, N-Myc tag MG52575-NM
TSPAN13 qPCR Primer Pairs, Mouse MP202446

TSPAN13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TSPAN13 cDNA ORF Clone in Cloning Vector, Human HG22080-U
TSPAN13 cDNA ORF Clone, Human, untagged HG22080-UT
TSPAN13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22080-ACGLN
TSPAN13 cDNA ORF Clone, Human, C-GFPSpark® tag HG22080-ACG
TSPAN13 cDNA ORF Clone, Human, N-GFPSpark® tag HG22080-ANG
TSPAN13 cDNA ORF Clone, Human, C-OFPSpark® tag HG22080-ACR
TSPAN13 cDNA ORF Clone, Human, N-OFPSpark® tag HG22080-ANR
TSPAN13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22080-CF
TSPAN13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22080-NF
TSPAN13 cDNA ORF Clone, Human, C-His tag HG22080-CH
TSPAN13 cDNA ORF Clone, Human, N-His tag HG22080-NH
TSPAN13 cDNA ORF Clone, Human, C-HA tag HG22080-CY
TSPAN13 cDNA ORF Clone, Human, N-HA tag HG22080-NY
TSPAN13 cDNA ORF Clone, Human, C-Myc tag HG22080-CM
TSPAN13 cDNA ORF Clone, Human, N-Myc tag HG22080-NM
info info
添加购物车成功! 添加购物车失败!