TRIB3 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50888-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TRIB3 Reagents
CRO Services
Product recommended

All TRIB3 Reagents
TRIB3 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Mouse tribbles homolog 3 (Drosophila) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRIB3 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Ifld2 cDNA ORF Clone, Mouse;Nipk cDNA ORF Clone, Mouse;SINK cDNA ORF Clone, Mouse;SKIP3 cDNA ORF Clone, Mouse;TRB-3 cDNA ORF Clone, Mouse;Trb3 cDNA ORF Clone, Mouse
TRIB3 Background Information

Tribbles homolog 3, also known as Neuronal cell death-inducible putative kinase, p65-interacting inhibitor of NF-kappa-B, SINK and TRIB3, is a Nucleus protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family and Tribbles subfamily. Highest expression Of TRIB3 is in liver, pancreas, peripheral blood leukocytes and bone marrow. It is also highly expressed in a number of primary lung, colon and breast tumors. TRIB3 is expressed in spleen, thymus, and prostate and is undetectable in other examined tissues, including testis, ovary, small intestine, colon, leukocyte, heart, brain, placenta, lung, skeletal muscle, and kidney. TRIB3 disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. TRIB3 may bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. It binds to ATF4 and inhibits its transcriptional activation activity. TRIB3 interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. It interacts with MAPK kinases and regulates activation of MAP kinases. It may play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. TRIB3 does not display kinase activity.

Full Name
tribbles pseudokinase 3
References
  • Wu M. et al., 2003, J. Biol. Chem. 278: 27072-9.
  • Kiss-Toth E. et al., 2004, J. Biol. Chem. 279: 42703-8.
  • Ord D., et al.,2005, Biochem. Biophys. Res. Commun. 330: 210-8.
  • Schwarzer R. et al., 2006, Cell. Signal. 18:899-909.
  • Greenman C. et al., 2007, Nature. 446:153-8.
  • TRIB3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TRIB3 cDNA ORF Clone in Cloning Vector, Mouse MG50888-G
    TRIB3 cDNA ORF Clone, Mouse, untagged MG50888-UT
    TRIB3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50888-ACGLN
    TRIB3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50888-ACG
    TRIB3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50888-ANG
    TRIB3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50888-ACR
    TRIB3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50888-ANR
    TRIB3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50888-CF
    TRIB3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50888-NF
    TRIB3 cDNA ORF Clone, Mouse, C-His tag MG50888-CH
    TRIB3 cDNA ORF Clone, Mouse, N-His tag MG50888-NH
    TRIB3 cDNA ORF Clone, Mouse, C-HA tag MG50888-CY
    TRIB3 cDNA ORF Clone, Mouse, N-HA tag MG50888-NY
    TRIB3 cDNA ORF Clone, Mouse, C-Myc tag MG50888-CM
    TRIB3 qPCR Primer Pairs, Mouse MP200859

    TRIB3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TRIB3 cDNA ORF Clone in Cloning Vector, Human HG10731-M
    TRIB3 cDNA ORF Clone, Human, untagged HG10731-UT
    TRIB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10731-ACG
    TRIB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10731-ACGLN
    TRIB3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10731-ANG
    TRIB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10731-ACR
    TRIB3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10731-ANR
    TRIB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10731-CF
    TRIB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10731-NF
    TRIB3 cDNA ORF Clone, Human, C-His tag HG10731-CH
    TRIB3 cDNA ORF Clone, Human, N-His tag HG10731-NH
    TRIB3 cDNA ORF Clone, Human, C-HA tag HG10731-CY
    TRIB3 cDNA ORF Clone, Human, N-HA tag HG10731-NY
    TRIB3 cDNA ORF Clone, Human, C-Myc tag HG10731-CM
    TRIB3 cDNA ORF Clone, Human, N-Myc tag HG10731-NM
    TRIB3 qPCR Primer Pairs, Human HP100669
    info info
    添加购物车成功! 添加购物车失败!