TREML2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50611-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TREML2 Reagents
CRO Services
Product recommended

All TREML2 Reagents
TREML2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Mouse triggering receptor expressed on myeloid cells-like 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TREML2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AW049306 cDNA ORF Clone, Mouse;Gm750 cDNA ORF Clone, Mouse;Tlt2 cDNA ORF Clone, Mouse
TREML2 Background Information

Trem-like transcript 2 protein, also known as Triggering receptor expressed on myeloid cells-like protein 2, TREML2 and TLT2, is a single-pass type I  membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. TREML2 is detected in cultured B cells, T cell leukemia and monocyte leukemia. TREML2 is expressed constitutively on CD8 T-cells and induced on CD4 T-cells after activation. TREML2 is a cell surface receptor that may play a role in the innate and adaptive immune response. TREML2 acts as a counter-receptor for CD276 and interaction with CD276 on T-cells enhances T-cell activation. Murine B7-H3 specifically bound to Triggering receptor expressed on myeloid cells (TREM)-like transcript 2 (TLT-2, TREML2). TREML2 was expressed on CD8(+) T cells constitutively and on activated CD4(+) T cells. Stimulation with B7-H3 transfectants preferentially up-regulated the proliferation and IFN-gamma production of CD8(+) T cells. Transduction of TREML2 into T cells resulted in enhanced IL-2 and IFN-gamma production via interactions with B7-H3. There maybe a direct interaction between B7-H3 and TREML2 that preferentially enhances CD8(+) T cell activation.

Full Name
triggering receptor expressed on myeloid cells like 2
References
  • Mungall A.J. et al., 2003, Nature. 425: 805-11.
  • Clark HF. et al., 2003, Genome Res. 13: 2265-70.
  • The MGC Project Team. et al., 2004, Genome Res. 14:2121-7.
  • Hashiguchi M., et al., 2008, Proc. Natl.Acad. Sci. USA.105:10495-500.
  • Leitner,J. et al., 2009, Eur J Immunol. 39 (7):1754-64.
  • TREML2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TREML2 cDNA ORF Clone in Cloning Vector, Mouse MG50611-M
    TREML2 cDNA ORF Clone, Mouse, untagged MG50611-UT
    TREML2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50611-ACG
    TREML2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50611-ACGLN
    TREML2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50611-ACR
    TREML2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50611-CF
    TREML2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50611-NF
    TREML2 cDNA ORF Clone, Mouse, C-His tag MG50611-CH
    TREML2 cDNA ORF Clone, Mouse, N-His tag MG50611-NH
    TREML2 cDNA ORF Clone, Mouse, N-HA tag MG50611-NY
    TREML2 cDNA ORF Clone, Mouse, C-Myc tag MG50611-CM
    TREML2 cDNA ORF Clone, Mouse, N-Myc tag MG50611-NM
    TREML2 qPCR Primer Pairs, Mouse MP200597

    TREML2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TREML2 cDNA ORF Clone in Cloning Vector, Human HG11655-M
    TREML2 cDNA ORF Clone, Human, untagged HG11655-UT
    TREML2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11655-ACGLN
    TREML2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11655-ACG
    TREML2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11655-ACR
    TREML2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11655-CF
    TREML2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11655-NF
    TREML2 cDNA ORF Clone, Human, C-His tag HG11655-CH
    TREML2 cDNA ORF Clone, Human, N-His tag HG11655-NH
    TREML2 cDNA ORF Clone, Human, C-HA tag HG11655-CY
    TREML2 cDNA ORF Clone, Human, N-HA tag HG11655-NY
    TREML2 cDNA ORF Clone, Human, C-Myc tag HG11655-CM
    TREML2 cDNA ORF Clone, Human, N-Myc tag HG11655-NM
    TREML2 qPCR Primer Pairs, Human HP101500
    info info
    添加购物车成功! 添加购物车失败!