TREM-2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50149-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TREM-2 Reagents
CRO Services
Product recommended

All TREM-2 Reagents
TREM-2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
684 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse triggering receptor expressed on myeloid cells 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + NotI (6kb + 0.72kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TREM-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TREM-2 cDNA ORF Clone, Mouse, N-His tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5646
TREM-2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
TREM-2 cDNA ORF Clone, Mouse;Trem2a cDNA ORF Clone, Mouse;Trem2b cDNA ORF Clone, Mouse;Trem2c cDNA ORF Clone, Mouse
TREM-2 Background Information

Triggering receptor expressed on myeloid cells 2 ( TREM2 ) is a single Ig domain receptor. It is expressed on macrophages and dendritic cells but not on granulocytes or monocytes. Its expression is most abundant in the basal ganglia, corpus callosum, medulla oblongata and spinal cord, and microglial cells are the major TREM2-producing cell type in the central nervous system (CNS). TREM2 may play a role in chronic inflammations and may stimulate production of constitutive rather than inflammatory chemokines and cytokines. TREM2 forms a receptor signaling complex with TYROBP and triggers activation of the immune responses in macrophages and dendritic cells. It also associates with the signal adapter protein, DAP12, which has a cytoplasmic ITAM, leading to the subsequent activation of cytoplasmic tyrosine kinases. TREM2 is both required and sufficient for competent uptake of apoptotic neuronal cells. TREM2 and TREM2-L form a receptor-ligand pair connecting microglia with apoptotic neurons, directing removal of damaged cells to allow repair. Deficiency of the adapter protein DAP12 or its associated receptor TREM2 is associated with abnormal osteoclast development in humans. Defects in TREM2 are causes of PLOSL, also known as NHD. In addition, TREM2 signaling is also an important pathway to promote healing of wounds in the colon where stem cell replacement is necessary.

Full Name
triggering receptor expressed on myeloid cells 2
References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Paloneva, J. et al., 2002, Am. J. Hum. Genet. 71:656-662. 
  • Prada, I. et al., 2006, Neuroscience. 140 (4): 1139-48.
  • Neumann, H. et al., 2007, J Neuroimmunol. 184 (1-2): 92-9.
  • Thrash, JC. et al., 2009, Neurochem Res. 34 (1): 38-45.
  • TREM-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TREM-2 cDNA ORF Clone in Cloning Vector, Mouse MG50149-M
    TREM-2 cDNA ORF Clone, Mouse, untagged MG50149-UT
    TREM-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50149-ACGLN
    TREM-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50149-ACG
    TREM-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50149-ACR
    TREM-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50149-CF
    TREM-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50149-NF
    TREM-2 cDNA ORF Clone, Mouse, C-His tag MG50149-CH
    TREM-2 cDNA ORF Clone, Mouse, C-HA tag MG50149-CY
    TREM-2 cDNA ORF Clone, Mouse, N-HA tag MG50149-NY
    TREM-2 cDNA ORF Clone, Mouse, C-Myc tag MG50149-CM
    TREM-2 cDNA ORF Clone, Mouse, N-Myc tag MG50149-NM
    TREM-2 qPCR Primer Pairs, Mouse MP200179

    TREM-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TREM-2 cDNA ORF Clone in Cloning Vector, Human HG11084-M
    TREM-2 cDNA ORF Clone, Human, untagged HG11084-UT
    TREM-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11084-ACG
    TREM-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11084-ACGLN
    TREM-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11084-ACR
    TREM-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11084-CF
    TREM-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11084-NF
    TREM-2 cDNA ORF Clone, Human, C-His tag HG11084-CH
    TREM-2 cDNA ORF Clone, Human, N-His tag HG11084-NH
    TREM-2 cDNA ORF Clone, Human, C-HA tag HG11084-CY
    TREM-2 cDNA ORF Clone, Human, N-HA tag HG11084-NY
    TREM-2 cDNA ORF Clone, Human, C-Myc tag HG11084-CM
    TREM-2 cDNA ORF Clone, Human, N-Myc tag HG11084-NM
    TREM-2 qPCR Primer Pairs, Human HP101005
    info info
    添加购物车成功! 添加购物车失败!