Quick Order

Text Size:AAA

Mouse TREM-2/TREM2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse TREM2 cDNA Clone Product Information
NCBI RefSeq:NM_031254.2
RefSeq ORF Size:684bp
cDNA Description:Full length Clone DNA of Mus musculus triggering receptor expressed on myeloid cells 2 with N terminal His tag.
Gene Synonym:Trem2a, Trem2b, Trem2c
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mTREM2
Restriction Site:KpnI + NotI (6kb + 0.72kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse TREM2 Gene Plasmid Map
Mouse TREM2 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Triggering receptor expressed on myeloid cells 2 ( TREM2 ) is a single Ig domain receptor. It is expressed on macrophages and dendritic cells but not on granulocytes or monocytes. Its expression is most abundant in the basal ganglia, corpus callosum, medulla oblongata and spinal cord, and microglial cells are the major TREM2-producing cell type in the central nervous system (CNS). TREM2 may play a role in chronic inflammations and may stimulate production of constitutive rather than inflammatory chemokines and cytokines. TREM2 forms a receptor signaling complex with TYROBP and triggers activation of the immune responses in macrophages and dendritic cells. It also associates with the signal adapter protein, DAP12, which has a cytoplasmic ITAM, leading to the subsequent activation of cytoplasmic tyrosine kinases. TREM2 is both required and sufficient for competent uptake of apoptotic neuronal cells. TREM2 and TREM2-L form a receptor-ligand pair connecting microglia with apoptotic neurons, directing removal of damaged cells to allow repair. Deficiency of the adapter protein DAP12 or its associated receptor TREM2 is associated with abnormal osteoclast development in humans. Defects in TREM2 are causes of PLOSL, also known as NHD. In addition, TREM2 signaling is also an important pathway to promote healing of wounds in the colon where stem cell replacement is necessary.

References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Paloneva, J. et al., 2002, Am. J. Hum. Genet. 71:656-662. 
  • Prada, I. et al., 2006, Neuroscience. 140 (4): 1139-48.
  • Neumann, H. et al., 2007, J Neuroimmunol. 184 (1-2): 92-9.
  • Thrash, JC. et al., 2009, Neurochem Res. 34 (1): 38-45.
  • Size / Price
    Catalog: MG50149-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse TREM2 natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"