TPM3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52799-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TPM3 Reagents
CRO Services
Product recommended

All TPM3 Reagents
TPM3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Mouse tropomyosin 3, gamma with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPM3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
gamma-TM cDNA ORF Clone, Mouse;hTM30nm cDNA ORF Clone, Mouse;hTMnm cDNA ORF Clone, Mouse;TM30nm cDNA ORF Clone, Mouse;Tm5NM cDNA ORF Clone, Mouse;TMnm cDNA ORF Clone, Mouse;Tpm-5 cDNA ORF Clone, Mouse;Tpm5 cDNA ORF Clone, Mouse;Trop-5 cDNA ORF Clone, Mouse
TPM3 Background Information
Full Name
tropomyosin 3

TPM3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TPM3 cDNA ORF Clone in Cloning Vector, Rat RG83517-U
TPM3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83517-ACGLN

TPM3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TPM3 cDNA ORF Clone in Cloning Vector, Mouse MG52799-G
TPM3 cDNA ORF Clone, Mouse, untagged MG52799-UT
TPM3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52799-ACGLN
TPM3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52799-ACG
TPM3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52799-ANG
TPM3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52799-ACR
TPM3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52799-ANR
TPM3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52799-NF
TPM3 cDNA ORF Clone, Mouse, C-His tag MG52799-CH
TPM3 cDNA ORF Clone, Mouse, N-His tag MG52799-NH
TPM3 cDNA ORF Clone, Mouse, C-HA tag MG52799-CY
TPM3 cDNA ORF Clone, Mouse, N-HA tag MG52799-NY
TPM3 cDNA ORF Clone, Mouse, C-Myc tag MG52799-CM
TPM3 cDNA ORF Clone, Mouse, N-Myc tag MG52799-NM

TPM3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TPM3 cDNA ORF Clone in Cloning Vector, Human HG16692-U
TPM3 cDNA ORF Clone, Human, untagged HG16692-UT
TPM3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16692-ACG
TPM3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16692-ACGLN
TPM3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16692-ANG
TPM3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16692-ACR
TPM3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16692-ANR
TPM3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16692-CF
TPM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16692-NF
TPM3 cDNA ORF Clone, Human, C-His tag HG16692-CH
TPM3 cDNA ORF Clone, Human, N-His tag HG16692-NH
TPM3 cDNA ORF Clone, Human, C-HA tag HG16692-CY
TPM3 cDNA ORF Clone, Human, N-HA tag HG16692-NY
TPM3 cDNA ORF Clone, Human, C-Myc tag HG16692-CM
TPM3 cDNA ORF Clone, Human, N-Myc tag HG16692-NM
info info
添加购物车成功! 添加购物车失败!